Morpholino

MO2-gnb1b

ID
ZDB-MRPHLNO-120123-2
Name
MO2-gnb1b
Previous Names
None
Target
Sequence
5' - CTGGTCCAGTTCACTCATTTTCCTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-gnb1b
No data available
Phenotype
Phenotype resulting from MO2-gnb1b
No data available
Phenotype of all Fish created by or utilizing MO2-gnb1b
Phenotype Fish Conditions Figures
neutrophil GFP expression spatial pattern, abnormal e114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 amputation: caudal fin Fig. 7 with image from Ke et al., 2017
neutrophil GFP expression spatial pattern, abnormal e116Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 amputation: caudal fin Fig. 8 with image from Ke et al., 2017
neutrophil chemotaxis decreased process quality, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 control Fig. 5 with image from Ke et al., 2017
neutrophil ab1-gnb1a labeling decreased amount, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 control Fig. 2 with image from Ke et al., 2017
neutrophil migration decreased occurrence, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 amputation: caudal fin Fig. 3 with image from Ke et al., 2017
neutrophil chemotaxis decreased occurrence, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 amputation: caudal fin Fig. 3 with image from Ke et al., 2017
neutrophil migration process quality, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 control Fig. 5 with image from Ke et al., 2017
neutrophil migration decreased process quality, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 control Fig. 5 with image from Ke et al., 2017
neutrophil migration process quality, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 amputation: caudal fin Fig. 3 with image from Ke et al., 2017
neutrophil activation decreased process quality, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 control Fig. 5 with image from Ke et al., 2017
neutrophil migration decreased process quality, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 amputation: caudal fin Fig. 3 with image from Ke et al., 2017
neutrophil chemotaxis decreased occurrence, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 control Fig. 5 with image from Ke et al., 2017
neutrophil chemotaxis decreased process quality, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 amputation: caudal fin Fig. 3 with image from Ke et al., 2017
neutrophil activation decreased occurrence, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 control Fig. 5 with image from Ke et al., 2017
neutrophil morphology, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 control Fig. 5 with image from Ke et al., 2017
neutrophil ab1-gnb labeling decreased amount, abnormal i114Tg + MO1-gnb1a + MO2-gnb1b + MO4-tp53 control Fig. 2 with image from Ke et al., 2017
posterior lateral line primordium filopodium decreased length, abnormal zf106Tg + MO2-gnb1a + MO2-gnb1b + MO4-tp53 standard conditions Fig. 5 with image from Xu et al., 2014
neuromast decreased amount, abnormal zf106Tg + MO2-gnb1a + MO2-gnb1b + MO4-tp53 standard conditions Fig. 2 with image from Xu et al., 2014
posterior lateral line neuromast deposition decreased process quality, abnormal zf106Tg + MO2-gnb1a + MO2-gnb1b + MO4-tp53 standard conditions Fig. 2 with image from Xu et al., 2014
posterior lateral line neuromast primordium migration disrupted, abnormal zf106Tg + MO2-gnb1a + MO2-gnb1b + MO4-tp53 standard conditions Fig. 2 with imageFig. 3 with imageFig. 7 with image from Xu et al., 2014
posterior lateral line neuromast primordium migration process quality, abnormal zf106Tg + MO2-gnb1a + MO2-gnb1b + MO4-tp53 standard conditions Fig. 2 with imageFig. 3 with imageFig. 7 with image from Xu et al., 2014
posterior lateral line primordium has fewer parts of type cell cell projection, abnormal zf106Tg + MO2-gnb1a + MO2-gnb1b + MO4-tp53 standard conditions Fig. 5 with image from Xu et al., 2014
neutrophil ab1-gnb1a labeling decreased amount, abnormal i114Tg + MO1-gnb1a + MO1-gnb4a + MO1-gnb4b + MO2-gnb1b + MO4-tp53 control Fig. 2 with image from Ke et al., 2017
neutrophil ab1-gnb labeling decreased amount, abnormal i114Tg + MO1-gnb1a + MO1-gnb4a + MO1-gnb4b + MO2-gnb1b + MO4-tp53 control Fig. 2 with image from Ke et al., 2017
posterior lateral line primordium actin filament bundle organization process quality, abnormal ui2Tg; zf106Tg + MO2-gnb1a + MO2-gnb1b + MO4-tp53 standard conditions Fig. 6 with image from Xu et al., 2014
posterior lateral line neuromast primordium migration process quality, abnormal cxcr4bt26035/+; zf106Tg + MO2-gnb1a + MO2-gnb1b + MO4-tp53 standard conditions Fig. 7 with image from Xu et al., 2014
posterior lateral line neuromast primordium migration disrupted, abnormal cxcr4bt26035/+; zf106Tg + MO2-gnb1a + MO2-gnb1b + MO4-tp53 standard conditions Fig. 7 with image from Xu et al., 2014
Citations