Morpholino

MO2-gnb1a

ID

ZDB-MRPHLNO-120123-1

Name

MO2-gnb1a

Previous Names

None

Target

gnb1a (1)

Sequence

5' - GAGTTCGCTCATTTTCTTCTGCTTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-gnb1a

No data available

Phenotype

Phenotype resulting from MO2-gnb1a

Phenotype	Fish	Figures
neuromast decreased amount, abnormal	zf106Tg + MO2-gnb1a + MO4-tp53	Fig. 2 from Xu et al., 2014
posterior lateral line neuromast deposition decreased process quality, abnormal	zf106Tg + MO2-gnb1a + MO4-tp53	Fig. 2 from Xu et al., 2014
posterior lateral line neuromast primordium migration disrupted, abnormal	zf106Tg + MO2-gnb1a + MO4-tp53	Fig. 2 from Xu et al., 2014
posterior lateral line neuromast primordium migration process quality, abnormal	zf106Tg + MO2-gnb1a + MO4-tp53	Fig. 2 from Xu et al., 2014

Phenotype of all Fish created by or utilizing MO2-gnb1a

Phenotype	Fish	Conditions	Figures
neuromast decreased amount, abnormal	zf106Tg + MO2-gnb1a + MO4-tp53	standard conditions	Fig. 2 from Xu et al., 2014
posterior lateral line neuromast primordium migration process quality, abnormal	zf106Tg + MO2-gnb1a + MO4-tp53	standard conditions	Fig. 2 from Xu et al., 2014
posterior lateral line neuromast primordium migration disrupted, abnormal	zf106Tg + MO2-gnb1a + MO4-tp53	standard conditions	Fig. 2 from Xu et al., 2014
posterior lateral line neuromast deposition decreased process quality, abnormal	zf106Tg + MO2-gnb1a + MO4-tp53	standard conditions	Fig. 2 from Xu et al., 2014
neutrophil chemotaxis decreased process quality, abnormal	i114Tg + MO2-gnb1a + MO3-gnb1b + MO4-tp53	amputation: caudal fin	Fig. 3 from Ke et al., 2017
neutrophil chemotaxis decreased occurrence, abnormal	i114Tg + MO2-gnb1a + MO3-gnb1b + MO4-tp53	amputation: caudal fin	Fig. 3 from Ke et al., 2017
neutrophil migration decreased occurrence, abnormal	i114Tg + MO2-gnb1a + MO3-gnb1b + MO4-tp53	amputation: caudal fin	Fig. 3 from Ke et al., 2017
neutrophil migration decreased process quality, abnormal	i114Tg + MO2-gnb1a + MO3-gnb1b + MO4-tp53	amputation: caudal fin	Fig. 3 from Ke et al., 2017
posterior lateral line primordium filopodium decreased length, abnormal	zf106Tg + MO2-gnb1a + MO2-gnb1b + MO4-tp53	standard conditions	Fig. 5 from Xu et al., 2014
neuromast decreased amount, abnormal	zf106Tg + MO2-gnb1a + MO2-gnb1b + MO4-tp53	standard conditions	Fig. 2 from Xu et al., 2014
posterior lateral line neuromast deposition decreased process quality, abnormal	zf106Tg + MO2-gnb1a + MO2-gnb1b + MO4-tp53	standard conditions	Fig. 2 from Xu et al., 2014
posterior lateral line neuromast primordium migration disrupted, abnormal	zf106Tg + MO2-gnb1a + MO2-gnb1b + MO4-tp53	standard conditions	Fig. 2 , Fig. 3 , Fig. 7 from Xu et al., 2014
posterior lateral line neuromast primordium migration process quality, abnormal	zf106Tg + MO2-gnb1a + MO2-gnb1b + MO4-tp53	standard conditions	Fig. 2 , Fig. 3 , Fig. 7 from Xu et al., 2014
posterior lateral line primordium has fewer parts of type cell cell projection, abnormal	zf106Tg + MO2-gnb1a + MO2-gnb1b + MO4-tp53	standard conditions	Fig. 5 from Xu et al., 2014
posterior lateral line primordium actin filament bundle organization process quality, abnormal	ui2Tg; zf106Tg + MO2-gnb1a + MO2-gnb1b + MO4-tp53	standard conditions	Fig. 6 from Xu et al., 2014
posterior lateral line neuromast primordium migration process quality, abnormal	cxcr4b^t26035/+; zf106Tg + MO2-gnb1a + MO2-gnb1b + MO4-tp53	standard conditions	Fig. 7 from Xu et al., 2014
posterior lateral line neuromast primordium migration disrupted, abnormal	cxcr4b^t26035/+; zf106Tg + MO2-gnb1a + MO2-gnb1b + MO4-tp53	standard conditions	Fig. 7 from Xu et al., 2014

Citations