Morpholino

MO3-vangl2

ID
ZDB-MRPHLNO-110614-5
Name
MO3-vangl2
Previous Names
  • MO vangl2-ATG (1)
Target
Sequence
5' - GTACTGCGACTCGTTATCCATGTCG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-vangl2
No data available
Phenotype
Phenotype resulting from MO3-vangl2
Phenotype Fish Figures
brain hydrocephalic, abnormal AB + MO3-vangl2 Fig. 5 with image from Bubenshchikova et al., 2012
ciliated cell mitotic spindle increased angle to pronephros apical-basal axis relative to substrate, abnormal AB + MO3-vangl2 Fig. 6 with image from Bubenshchikova et al., 2012
cloacal chamber malformed, abnormal AB + MO3-vangl2 Fig. 5 with image from Bubenshchikova et al., 2012
cloacal chamber ciliated cell decreased amount, abnormal AB + MO3-vangl2 Fig. 5 with image from Bubenshchikova et al., 2012
establishment of mitotic spindle orientation disrupted, abnormal AB + MO3-vangl2 Fig. 6 with image from Bubenshchikova et al., 2012
pericardium edematous, abnormal AB + MO3-vangl2 Fig. 5 with image from Bubenshchikova et al., 2012
pronephros cystic, abnormal AB + MO3-vangl2 Fig. 5 with image from Bubenshchikova et al., 2012
pronephros ciliated cell decreased amount, abnormal AB + MO3-vangl2 Fig. 5 with image from Bubenshchikova et al., 2012
trunk curved, abnormal AB + MO3-vangl2 Fig. 5 with image from Bubenshchikova et al., 2012
Phenotype of all Fish created by or utilizing MO3-vangl2
Phenotype Fish Conditions Figures
cloacal chamber ciliated cell decreased amount, abnormal AB + MO3-vangl2 standard conditions Fig. 5 with image from Bubenshchikova et al., 2012
trunk curved, abnormal AB + MO3-vangl2 standard conditions Fig. 5 with image from Bubenshchikova et al., 2012
establishment of mitotic spindle orientation disrupted, abnormal AB + MO3-vangl2 standard conditions Fig. 6 with image from Bubenshchikova et al., 2012
brain hydrocephalic, abnormal AB + MO3-vangl2 standard conditions Fig. 5 with image from Bubenshchikova et al., 2012
pronephros ciliated cell decreased amount, abnormal AB + MO3-vangl2 standard conditions Fig. 5 with image from Bubenshchikova et al., 2012
pronephros cystic, abnormal AB + MO3-vangl2 standard conditions Fig. 5 with image from Bubenshchikova et al., 2012
ciliated cell mitotic spindle increased angle to pronephros apical-basal axis relative to substrate, abnormal AB + MO3-vangl2 standard conditions Fig. 6 with image from Bubenshchikova et al., 2012
cloacal chamber malformed, abnormal AB + MO3-vangl2 standard conditions Fig. 5 with image from Bubenshchikova et al., 2012
pericardium edematous, abnormal AB + MO3-vangl2 standard conditions Fig. 5 with image from Bubenshchikova et al., 2012
pronephros ciliated cell decreased amount, abnormal AB + MO2-wtip + MO3-vangl2 standard conditions Fig. 5 with image from Bubenshchikova et al., 2012
ciliated cell cilium decreased length, abnormal AB + MO2-wtip + MO3-vangl2 standard conditions Fig. 5 with image from Bubenshchikova et al., 2012
establishment of mitotic spindle orientation disrupted, abnormal AB + MO2-wtip + MO3-vangl2 standard conditions Fig. 6 with image from Bubenshchikova et al., 2012
ciliated cell mitotic spindle increased angle to pronephros apical-basal axis relative to substrate, abnormal AB + MO2-wtip + MO3-vangl2 standard conditions Fig. 6 with image from Bubenshchikova et al., 2012
cloacal chamber ciliated cell decreased amount, abnormal AB + MO2-wtip + MO3-vangl2 standard conditions Fig. 5 with image from Bubenshchikova et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.