Morpholino

MO2-gmds

ID

ZDB-MRPHLNO-101118-4

Name

MO2-gmds

Previous Names

None

Target

Sequence

5' - CGTATGTTTGCTGACCATAAGGCGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-gmds

Expressed Gene	Anatomy	Figures
efnb2a	dorsal aorta blood vessel endothelial cell	Fig. S4 from Fowler et al., 2021
ephb4a	posterior cardinal vein blood vessel endothelial cell	Fig. S4 from Fowler et al., 2021
flt4	brain vasculature blood vessel endothelial cell posterior cardinal vein blood vessel endothelial cell	Fig. S4 from Fowler et al., 2021

Phenotype

Phenotype resulting from MO2-gmds

Phenotype	Fish	Figures
axon guidance disrupted, abnormal	WT + MO2-gmds	Fig. 6 from Song et al., 2010
brain vasculature hemorrhagic, abnormal	AB + MO2-gmds	Fig. 1 from Fowler et al., 2021
brain vasculature mislocalised, abnormal	AB + MO2-gmds	Fig. 4 from Fowler et al., 2021
post-vent region curved, abnormal	AB + MO2-gmds	Fig. 1 from Fowler et al., 2021
secondary motor neuron decreased amount, abnormal	WT + MO2-gmds	Fig. 6 from Song et al., 2010
secondary motor neuron axon morphology, abnormal	WT + MO2-gmds	Fig. 6 from Song et al., 2010
spinal cord glial cell decreased amount, abnormal	WT + MO2-gmds	Fig. 6 from Song et al., 2010
thigmotaxis decreased process quality, abnormal	AB + MO2-gmds	Fig. 1 from Fowler et al., 2021

Phenotype of all Fish created by or utilizing MO2-gmds

Phenotype	Fish	Conditions	Figures
brain vasculature hemorrhagic, abnormal	AB + MO2-gmds	control	Fig. 1 from Fowler et al., 2021
post-vent region curved, abnormal	AB + MO2-gmds	control	Fig. 1 from Fowler et al., 2021
thigmotaxis decreased process quality, abnormal	AB + MO2-gmds	control	Fig. 1 from Fowler et al., 2021
brain vasculature mislocalised, abnormal	AB + MO2-gmds	control	Fig. 4 from Fowler et al., 2021
axon guidance disrupted, abnormal	WT + MO2-gmds	standard conditions	Fig. 6 from Song et al., 2010
spinal cord glial cell decreased amount, abnormal	WT + MO2-gmds	standard conditions	Fig. 6 from Song et al., 2010
secondary motor neuron axon morphology, abnormal	WT + MO2-gmds	standard conditions	Fig. 6 from Song et al., 2010
secondary motor neuron decreased amount, abnormal	WT + MO2-gmds	standard conditions	Fig. 6 from Song et al., 2010

Citations