Morpholino
MO1-pkd1b
- ID
- ZDB-MRPHLNO-100707-3
- Name
- MO1-pkd1b
- Previous Names
-
- pkd1b MO ex45 (1)
- Target
- Sequence
-
5' - ACATGATATTTGTACCTCTTTGGTT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
splice-blocker
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-pkd1b
| Expressed Gene | Anatomy | Figures |
|---|---|---|
| col9a2 |
Fig. S4 
from Coxam et al., 2014 |
|
| cxcl12a |
Fig. S1
from Coxam et al., 2014 |
|
| cxcl12b |
Fig. S1
from Coxam et al., 2014 |
|
| cxcr4a |
Fig. S1
from Coxam et al., 2014 |
|
| cxcr4b |
Fig. S1
from Coxam et al., 2014 |
1 - 5 of 5
Phenotype
Phenotype resulting from MO1-pkd1b
No data available
Phenotype of all Fish created by or utilizing MO1-pkd1b
1 - 5 of 25 Show all
Citations
- Merrick, D., Mistry, K., Wu, J., Gresko, N., Baggs, J.E., Hogenesch, J.B., Sun, Z., Caplan, M.J. (2018) Polycystin-1 regulates bone development through an interaction with the transcriptional co-activator taz. Human molecular genetics. 28(1):16-30
- Chang, M.Y., Ma, T.L., Hung, C.C., Tian, Y.C., Chen, Y.C., Yang, C.W., Cheng, Y.C. (2017) Metformin Inhibits Cyst Formation in a Zebrafish Model of Polycystin-2 Deficiency. Scientific Reports. 7:7161
- Coxam, B., Sabine, A., Bower, N.I., Smith, K.A., Pichol-Thievend, C., Skoczylas, R., Astin, J.W., Frampton, E., Jaquet, M., Crosier, P.S., Parton, R.G., Harvey, N.L., Petrova, T.V., Schulte-Merker, S., Francois, M., Hogan, B.M. (2014) Pkd1 Regulates Lymphatic Vascular Morphogenesis during Development. Cell Reports. 7:623-33
- Merrick, D., Chapin, H., Baggs, J.E., Yu, Z., Somlo, S., Sun, Z., Hogenesch, J.B., and Caplan, M.J. (2012) The γ-Secretase Cleavage Product of Polycystin-1 Regulates TCF and CHOP-Mediated Transcriptional Activation through a p300-Dependent Mechanism. Developmental Cell. 22(1):197-210
- Mangos, S., Lam, P.Y., Zhao, A., Liu, Y., Mudumana, S., Vasilyev, A., Liu, A., and Drummond, I.A. (2010) The ADPKD genes pkd1a/b and pkd2 regulate extracellular matrix formation. Disease models & mechanisms. 3(5-6):354-365
1 - 5 of 5
Show