Morpholino

MO2-esr1

ID
ZDB-MRPHLNO-100624-3
Name
MO2-esr1
Previous Names
None
Target
Sequence
5' - AGGAAGGTTCCTCCAGGGCTTCTCT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-esr1
Expressed Gene Anatomy Figures
comtb Fig. 7 from Bertotto et al., 2018
drd1b Fig. 6 from Bertotto et al., 2018
mao Fig. 7 from Bertotto et al., 2018
runx1 Fig. 2 with image from Carroll et al., 2014
vtg1 Fig. 5 from Bertotto et al., 2018
Phenotype
Phenotype resulting from MO2-esr1
Phenotype Fish Figures
whole organism mao expression decreased amount, abnormal SPF 5-D + MO2-esr1 Fig. 7 from Bertotto et al., 2018
whole organism comtb expression decreased amount, abnormal SPF 5-D + MO2-esr1 Fig. 7 from Bertotto et al., 2018
whole organism vtg1 expression decreased amount, abnormal SPF 5-D + MO2-esr1 Fig. 5 from Bertotto et al., 2018
whole organism drd1b expression decreased amount, abnormal SPF 5-D + MO2-esr1 Fig. 6 from Bertotto et al., 2018
Phenotype of all Fish created by or utilizing MO2-esr1
Phenotype Fish Conditions Figures
whole organism vtg1 expression decreased amount, abnormal SPF 5-D + MO2-esr1 chemical treatment by environment: 17alpha-ethynylestradiol Fig. 5 from Bertotto et al., 2018
whole organism drd1b expression decreased amount, abnormal SPF 5-D + MO2-esr1 chemical treatment by environment: 17alpha-ethynylestradiol Fig. 6 from Bertotto et al., 2018
whole organism mao expression decreased amount, abnormal SPF 5-D + MO2-esr1 control Fig. 7 from Bertotto et al., 2018
whole organism comtb expression decreased amount, abnormal SPF 5-D + MO2-esr1 chemical treatment by environment: 17alpha-ethynylestradiol Fig. 7 from Bertotto et al., 2018
whole organism vtg1 expression decreased amount, abnormal SPF 5-D + MO2-esr1 control Fig. 5 from Bertotto et al., 2018
whole organism drd1b expression decreased amount, abnormal SPF 5-D + MO2-esr1 chemical treatment by environment: bifenthrin Fig. 6 from Bertotto et al., 2018
whole organism comtb expression decreased amount, abnormal SPF 5-D + MO2-esr1 control Fig. 7 from Bertotto et al., 2018
whole organism vtg1 expression decreased amount, abnormal SPF 5-D + MO2-esr1 chemical treatment by environment: bifenthrin Fig. 5 from Bertotto et al., 2018
whole organism drd1b expression decreased amount, abnormal SPF 5-D + MO2-esr1 control Fig. 6 from Bertotto et al., 2018
whole organism mao expression decreased amount, abnormal SPF 5-D + MO2-esr1 chemical treatment by environment: 17alpha-ethynylestradiol Fig. 7 from Bertotto et al., 2018
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal WT + MO2-esr1 chemical treatment by environment: 17beta-estradiol Fig. 2 with image from Carroll et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.