Morpholino
MO1-tardbpb
- ID
- ZDB-MRPHLNO-100506-1
- Name
- MO1-tardbpb
- Previous Names
-
- AMO (1)
- MO1-tardbp
- Target
- Sequence
-
5' - GTACATCTCGGCCATCTTTCCTCAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This is the corrected sequence for the tardbp MO published in Hum. Mol. Genet. 19(4): 671-683.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tardbpb
Expressed Gene | Anatomy | Figures |
---|---|---|
ache |
Figure 2 ![]() |
|
chrna1 |
Figure 1 ![]() |
|
chrng |
Figure 1 ![]() |
|
hdac4 |
Figure 1 ![]() |
|
pls3 |
Fig. 1
from Hao et al., 2012 |
1 - 5 of 6 Show all
Phenotype
Phenotype resulting from MO1-tardbpb
1 - 5 of 16 Show all
Phenotype of all Fish created by or utilizing MO1-tardbpb
1 - 5 of 20 Show all
Citations
- Campanari, M.L., Marian, A., Ciura, S., Kabashi, E. (2021) TDP-43 Regulation of AChE Expression Can Mediate ALS-Like Phenotype in Zebrafish. Cells. 10(2):
- Demy, D.L., Campanari, M.L., Munoz-Ruiz, R., Durham, H.D., Gentil, B.J., Kabashi, E. (2020) Functional Characterization of Neurofilament Light Splicing and Misbalance in Zebrafish. Cells. 9(5):
- Chitramuthu, B.P., Kay, D.G., Bateman, A., Bennett, H.P. (2017) Neurotrophic effects of progranulin in vivo in reversing motor neuron defects caused by over or under expression of TDP-43 or FUS. PLoS One. 12:e0174784
- Hao, L.T., Wolman, M., Granato, M., and Beattie, C.E. (2012) Survival motor neuron affects plastin 3 protein levels leading to motor defects. The Journal of neuroscience : the official journal of the Society for Neuroscience. 32(15):5074-5084
- Kabashi, E., Bercier, V., Lissouba, A., Liao, M., Brustein, E., Rouleau, G.A, and Drapeau, P. (2011) FUS and TARDBP but Not SOD1 Interact in Genetic Models of Amyotrophic Lateral Sclerosis. PLoS Genetics. 7(8):e1002214
- Kabashi, E., Lin, L., Tradewell, M.L., Dion, P.A., Bercier, V., Bourgouin, P., Rochefort, D., Bel Hadj, S., Durham, H.D., Vande Velde, C., Rouleau, G.A., and Drapeau, P. (2010) Gain and loss of function of ALS-related mutations of TARDBP (TDP-43) cause motor deficits in vivo. Human molecular genetics. 19(4):671-683
1 - 6 of 6
Show