Morpholino

MO1-arl13b

ID
ZDB-MRPHLNO-100113-3
Name
MO1-arl13b
Previous Names
  • hi459 oligo 2 (1)
Target
Sequence
5' - TTTCCCCCCTAAATGCTTTCACTGG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
translation-blocker
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-arl13b
Expressed Gene Anatomy Figures
arl13b Fig. 4 with image from Duldulao et al., 2009
atoh1a Fig. 2 with image from Zhu et al., 2020
atoh1b Fig. 2 with image from Zhu et al., 2020
atoh1c Fig. 2 with image from Zhu et al., 2020
myl7 Fig. 5 with image from Duldulao et al., 2009
ptf1a Fig. 4 with image from Zhu et al., 2020
reln Fig. 3 with image from Zhu et al., 2020
roraa Fig. 4 with image from Zhu et al., 2020
spaw Fig. 5 with image from Duldulao et al., 2009
zic1 Fig. 3 with image from Zhu et al., 2020
Phenotype
Phenotype resulting from MO1-arl13b
Phenotype Fish Figures
axis decreased length, abnormal WT + MO1-arl13b Fig. 2 with image from Duldulao et al., 2009
cerebellar granule cell differentiation decreased occurrence, abnormal nl1Tg + MO1-arl13b Fig. 3 with image from Zhu et al., 2020
cerebellar Purkinje cell differentiation decreased occurrence, abnormal AB + MO1-arl13b Fig. 4 with image from Zhu et al., 2020
cerebellum morphogenesis decreased process quality, abnormal nl1Tg + MO1-arl13b Fig. 6 with image from Zhu et al., 2020
convergent extension involved in gastrulation process quality, abnormal WT + MO1-arl13b Fig. 2 with image from Duldulao et al., 2009
corpus cerebelli atoh1c expression decreased amount, abnormal AB + MO1-arl13b Fig. 2 with image from Zhu et al., 2020
corpus cerebelli dorso-medial region atoh1a expression absent, abnormal AB + MO1-arl13b Fig. 2 with image from Zhu et al., 2020
corpus cerebelli dorso-medial region zic1 expression decreased amount, abnormal AB + MO1-arl13b Fig. 3 with image from Zhu et al., 2020
corpus cerebelli dorso-medial region reln expression decreased amount, abnormal AB + MO1-arl13b Fig. 3 with image from Zhu et al., 2020
corpus cerebelli dorso-medial region EGFP expression decreased amount, abnormal nl1Tg + MO1-arl13b Fig. 3 with image,  Fig. 6 with image from Zhu et al., 2020
determination of left/right asymmetry in lateral mesoderm process quality, abnormal WT + MO1-arl13b Fig. 5 with image from Duldulao et al., 2009
determination of left/right symmetry process quality, abnormal WT + MO1-arl13b Fig. 5 with image from Duldulao et al., 2009
granular layer corpus cerebelli has fewer parts of type cerebellar granule cell, abnormal nl1Tg + MO1-arl13b Fig. 6 with image from Zhu et al., 2020
heart bilateral symmetry, abnormal WT + MO1-arl13b Fig. 5 with image from Duldulao et al., 2009
lateral plate mesoderm bilateral symmetry, abnormal WT + MO1-arl13b Fig. 5 with image from Duldulao et al., 2009
molecular layer corpus cerebelli parallel fiber disorganized, abnormal nl1Tg + MO1-arl13b Fig. 3 with image from Zhu et al., 2020
parallel fiber axon development decreased process quality, abnormal AB + MO1-arl13b Fig. 1 with image from Zhu et al., 2020
post-vent region increased curvature, abnormal WT + MO1-arl13b Table 2 from Sun et al., 2004
pronephric duct motile cilium decreased length, abnormal sq5713Tg + MO1-arl13b Fig. 4 with image from Lu et al., 2015
pronephros cystic, abnormal WT + MO1-arl13b Fig. 7 from Jin et al., 2019
Table 2 from Sun et al., 2004
Purkinje cell layer corpus cerebelli has fewer parts of type Purkinje cell, abnormal AB + MO1-arl13b Fig. 4 with image from Zhu et al., 2020
Purkinje cell layer corpus cerebelli dorso-medial region ab1-pvalb labeling decreased amount, abnormal AB + MO1-arl13b Fig. 4 with image from Zhu et al., 2020
Purkinje cell layer corpus cerebelli dorso-medial region ptf1a expression decreased amount, abnormal AB + MO1-arl13b Fig. 4 with image from Zhu et al., 2020
Purkinje cell layer corpus cerebelli dorso-medial region has fewer parts of type Purkinje cell, abnormal AB + MO1-arl13b Fig. 4 with image from Zhu et al., 2020
somite increased width, abnormal WT + MO1-arl13b Fig. 2 with image from Duldulao et al., 2009
swimming decreased process quality, abnormal AB + MO1-arl13b Fig. 1 with image from Zhu et al., 2020
trunk increased width, abnormal WT + MO1-arl13b Fig. 2 with image from Duldulao et al., 2009
Phenotype of all Fish created by or utilizing MO1-arl13b
Phenotype Fish Conditions Figures
swimming decreased process quality, abnormal AB + MO1-arl13b standard conditions Fig. 1 with image from Zhu et al., 2020
corpus cerebelli dorso-medial region zic1 expression decreased amount, abnormal AB + MO1-arl13b standard conditions Fig. 3 with image from Zhu et al., 2020
corpus cerebelli atoh1c expression decreased amount, abnormal AB + MO1-arl13b standard conditions Fig. 2 with image from Zhu et al., 2020
cerebellar granule cell differentiation decreased occurrence, abnormal AB + MO1-arl13b standard conditions Fig. 3 with image from Zhu et al., 2020
Purkinje cell layer corpus cerebelli dorso-medial region ab1-pvalb labeling decreased amount, abnormal AB + MO1-arl13b standard conditions Fig. 4 with image from Zhu et al., 2020
Purkinje cell layer corpus cerebelli dorso-medial region has fewer parts of type Purkinje cell, abnormal AB + MO1-arl13b standard conditions Fig. 4 with image from Zhu et al., 2020
corpus cerebelli dorso-medial region atoh1a expression absent, abnormal AB + MO1-arl13b standard conditions Fig. 2 with image from Zhu et al., 2020
Purkinje cell layer corpus cerebelli dorso-medial region ptf1a expression decreased amount, abnormal AB + MO1-arl13b standard conditions Fig. 4 with image from Zhu et al., 2020
parallel fiber axon development decreased process quality, abnormal AB + MO1-arl13b standard conditions Fig. 1 with image from Zhu et al., 2020
cerebellar Purkinje cell differentiation decreased occurrence, abnormal AB + MO1-arl13b standard conditions Fig. 4 with image from Zhu et al., 2020
corpus cerebelli dorso-medial region reln expression decreased amount, abnormal AB + MO1-arl13b standard conditions Fig. 3 with image from Zhu et al., 2020
Purkinje cell layer corpus cerebelli has fewer parts of type Purkinje cell, abnormal AB + MO1-arl13b standard conditions Fig. 4 with image from Zhu et al., 2020
pronephros cystic, abnormal TU + MO1-arl13b standard conditions Fig. 7 from Jin et al., 2019
pronephros cystic, abnormal WT + MO1-arl13b standard conditions Table 2 from Sun et al., 2004
trunk increased width, abnormal WT + MO1-arl13b standard conditions Fig. 2 with image from Duldulao et al., 2009
post-vent region increased curvature, abnormal WT + MO1-arl13b standard conditions Table 2 from Sun et al., 2004
somite increased width, abnormal WT + MO1-arl13b standard conditions Fig. 2 with image from Duldulao et al., 2009
determination of left/right asymmetry in lateral mesoderm process quality, abnormal WT + MO1-arl13b standard conditions Fig. 5 with image from Duldulao et al., 2009
determination of left/right symmetry process quality, abnormal WT + MO1-arl13b standard conditions Fig. 5 with image from Duldulao et al., 2009
convergent extension involved in gastrulation process quality, abnormal WT + MO1-arl13b standard conditions Fig. 2 with image from Duldulao et al., 2009
axis decreased length, abnormal WT + MO1-arl13b standard conditions Fig. 2 with image from Duldulao et al., 2009
heart bilateral symmetry, abnormal WT + MO1-arl13b standard conditions Fig. 5 with image from Duldulao et al., 2009
lateral plate mesoderm bilateral symmetry, abnormal WT + MO1-arl13b standard conditions Fig. 5 with image from Duldulao et al., 2009
corpus cerebelli dorso-medial region EGFP expression decreased amount, abnormal nl1Tg + MO1-arl13b standard conditions Fig. 3 with image,  Fig. 6 with image from Zhu et al., 2020
corpus cerebelli dorso-medial region EGFP expression amount, ameliorated nl1Tg + MO1-arl13b chemical treatment by environment: lithium chloride Fig. 6 with image from Zhu et al., 2020
granular layer corpus cerebelli has number of cerebellar granule cell, ameliorated nl1Tg + MO1-arl13b chemical treatment by environment: lithium chloride Fig. 6 with image from Zhu et al., 2020
cerebellar granule cell differentiation decreased occurrence, abnormal nl1Tg + MO1-arl13b standard conditions Fig. 3 with image from Zhu et al., 2020
cerebellum morphogenesis process quality, ameliorated nl1Tg + MO1-arl13b chemical treatment by environment: lithium chloride Fig. 6 with image from Zhu et al., 2020
granular layer corpus cerebelli has fewer parts of type cerebellar granule cell, abnormal nl1Tg + MO1-arl13b standard conditions Fig. 6 with image from Zhu et al., 2020
cerebellum morphogenesis decreased process quality, abnormal nl1Tg + MO1-arl13b standard conditions Fig. 6 with image from Zhu et al., 2020
molecular layer corpus cerebelli parallel fiber disorganized, abnormal nl1Tg + MO1-arl13b standard conditions Fig. 3 with image from Zhu et al., 2020
pronephric duct motile cilium decreased length, abnormal sq5713Tg + MO1-arl13b heat shock Fig. 4 with image from Lu et al., 2015
pronephric duct motile cilium decreased length, abnormal sq5713Tg + MO1-arl13b standard conditions Fig. 4 with image from Lu et al., 2015
pronephros cystic, exacerbated TU + MO1-arl13b + MO1-cldn3c standard conditions Fig. 7 from Jin et al., 2019
pronephros cystic, exacerbated TU + MO1-arl13b + MO1-cldn7b standard conditions Fig. 7 from Jin et al., 2019
eye decreased size, abnormal WT + MO1-arl13b + MO1-exoc5 standard conditions Fig. 5 with image from Seixas et al., 2016
pericardium edematous, abnormal WT + MO1-arl13b + MO1-exoc5 standard conditions Fig. 5 with image from Seixas et al., 2016
post-vent region curved, abnormal WT + MO1-arl13b + MO1-exoc5 standard conditions Fig. 5 with image from Seixas et al., 2016
pericardium edematous, abnormal WT + MO1-arl13b + MO2-yap1 control Fig. 7 from He et al., 2015
pronephros cystic, abnormal WT + MO1-arl13b + MO2-yap1 control Fig. 7 from He et al., 2015
eye decreased size, abnormal WT + MO1-arl13b + MO2-yap1 control Fig. 7 from He et al., 2015
caudal fin curved, abnormal WT + MO1-arl13b + MO2-yap1 control Fig. 7 from He et al., 2015
somite cilium decreased length, abnormal sq5714Tg + MO1-arl13b standard conditions Fig. 4 with image from Lu et al., 2015
somite cilium decreased length, abnormal sq5714Tg + MO1-arl13b heat shock Fig. 4 with image from Lu et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.