Morpholino

MO1-gad1b

ID

ZDB-MRPHLNO-090707-2

Name

MO1-gad1b

Previous Names

gad1MO (1)
MO1-gad1

Target

gad1b (1)

Sequence

5' - AAGGTGCAGAAGACGCCATCAGTCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-gad1b

Expressed Gene	Anatomy	Figures
foxd3	cranial neural crest	Fig. S22 from O'Connor et al., 2018
prdm1a	cranial neural crest	Fig. S22 from O'Connor et al., 2018
snai1b	cranial neural crest	Fig. S22 from O'Connor et al., 2018
tfap2a	brain anterior region	Fig. S22 from O'Connor et al., 2018

Phenotype

Phenotype resulting from MO1-gad1b

Phenotype	Fish	Figures
basihyal cartilage asymmetrical, abnormal	WIK + MO1-gad1b	Fig. 7 from O'Connor et al., 2018
basihyal cartilage determination of left/right symmetry disrupted, abnormal	WIK + MO1-gad1b	Fig. 7 from O'Connor et al., 2018
brain anterior region tfap2a expression decreased distribution, abnormal	WIK + MO1-gad1b	Fig. S22 from O'Connor et al., 2018
chondrocranium decreased size, abnormal	WIK + MO1-gad1b	Fig. 7 from O'Connor et al., 2018
cranial neural crest snai1b expression increased distribution, abnormal	WIK + MO1-gad1b	Fig. S22 from O'Connor et al., 2018
cranial neural crest foxd3 expression increased distribution, abnormal	WIK + MO1-gad1b	Fig. S22 from O'Connor et al., 2018
ethmoid cartilage bilateral symmetry, abnormal	WIK + MO1-gad1b	Fig. 7 from O'Connor et al., 2018
hindbrain morphology, abnormal	WIK + MO1-gad1b	Fig. 5 from O'Connor et al., 2018
Meckel's cartilage decreased length, abnormal	WIK + MO1-gad1b	Fig. 7 from O'Connor et al., 2018
Meckel's cartilage chondrocyte crowded, abnormal	WIK + MO1-gad1b	Fig. 7 from O'Connor et al., 2018
Meckel's cartilage chondrocyte mislocalised, abnormal	WIK + MO1-gad1b	Fig. 7 from O'Connor et al., 2018
Meckel's cartilage chondrocyte morphogenesis disrupted, abnormal	WIK + MO1-gad1b	Fig. 7 from O'Connor et al., 2018
midbrain morphology, abnormal	WIK + MO1-gad1b	Fig. 5 from O'Connor et al., 2018
neurocranial trabecula decreased length, abnormal	WIK + MO1-gad1b	Fig. 7 from O'Connor et al., 2018
optic tectum transmission of nerve impulse occurrence, abnormal	WIK + MO1-gad1b	Fig. S26 from O'Connor et al., 2018
oral region head mesenchyme spatial pattern, abnormal	WIK + MO1-gad1b	Fig. 5 from O'Connor et al., 2018
ventral mandibular arch decreased size, abnormal	WIK + MO1-gad1b	Fig. 6 from O'Connor et al., 2018

Phenotype of all Fish created by or utilizing MO1-gad1b

Phenotype	Fish	Conditions	Figures
ventral mandibular arch decreased size, abnormal	WIK + MO1-gad1b	standard conditions	Fig. 6 from O'Connor et al., 2018
Meckel's cartilage decreased length, abnormal	WIK + MO1-gad1b	standard conditions	Fig. 7 from O'Connor et al., 2018
Meckel's cartilage chondrocyte mislocalised, abnormal	WIK + MO1-gad1b	standard conditions	Fig. 7 from O'Connor et al., 2018
cranial neural crest snai1b expression increased distribution, abnormal	WIK + MO1-gad1b	standard conditions	Fig. S22 from O'Connor et al., 2018
neurocranial trabecula decreased length, abnormal	WIK + MO1-gad1b	standard conditions	Fig. 7 from O'Connor et al., 2018
ethmoid cartilage bilateral symmetry, abnormal	WIK + MO1-gad1b	standard conditions	Fig. 7 from O'Connor et al., 2018
Meckel's cartilage chondrocyte morphogenesis disrupted, abnormal	WIK + MO1-gad1b	standard conditions	Fig. 7 from O'Connor et al., 2018
optic tectum transmission of nerve impulse occurrence, abnormal	WIK + MO1-gad1b	standard conditions	Fig. S26 from O'Connor et al., 2018
cranial neural crest foxd3 expression increased distribution, abnormal	WIK + MO1-gad1b	standard conditions	Fig. S22 from O'Connor et al., 2018
hindbrain morphology, abnormal	WIK + MO1-gad1b	standard conditions	Fig. 5 from O'Connor et al., 2018
basihyal cartilage determination of left/right symmetry disrupted, abnormal	WIK + MO1-gad1b	standard conditions	Fig. 7 from O'Connor et al., 2018
basihyal cartilage asymmetrical, abnormal	WIK + MO1-gad1b	standard conditions	Fig. 7 from O'Connor et al., 2018
midbrain morphology, abnormal	WIK + MO1-gad1b	standard conditions	Fig. 5 from O'Connor et al., 2018
chondrocranium decreased size, abnormal	WIK + MO1-gad1b	standard conditions	Fig. 7 from O'Connor et al., 2018
oral region head mesenchyme spatial pattern, abnormal	WIK + MO1-gad1b	standard conditions	Fig. 5 from O'Connor et al., 2018
Meckel's cartilage chondrocyte crowded, abnormal	WIK + MO1-gad1b	standard conditions	Fig. 7 from O'Connor et al., 2018
brain anterior region tfap2a expression decreased distribution, abnormal	WIK + MO1-gad1b	standard conditions	Fig. S22 from O'Connor et al., 2018
optic tectum transmission of nerve impulse occurrence, exacerbated	WIK + MO1-gad1b + MO1-gad2	standard conditions	Fig. S26 from O'Connor et al., 2018

Citations