Morpholino

MO1-yap1

ID

ZDB-MRPHLNO-090609-10

Name

MO1-yap1

Previous Names

None

Target

yap1 (1)

Sequence

5' - AGCAACATTAACAACTCACTTTAGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

2e2i

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-yap1

Expressed Gene	Anatomy	Figures
ccn2a	endoderm	Fig. 4 from Fukui et al., 2014
foxa2	endoderm notochord pharyngeal endoderm	Fig. 2 from Fukui et al., 2014
ins	posterior pancreatic bud	Fig. S7 from Cebola et al., 2015
myl7	heart tube myocardium	Fig. 1 from Fukui et al., 2014
pdx1	pancreatic bud	Fig. 7 from Cebola et al., 2015
rfng	rhombomere 1 posterior margin rhombomere 2 posterior margin rhombomere 3 posterior margin rhombomere 4 posterior margin rhombomere 5 posterior margin rhombomere 6 posterior margin	Figure 5 from Cayuso et al., 2019
sox9b	head (not) pancreatic bud pectoral fin bud	Fig. 7 from Cebola et al., 2015
sox17	endoderm	Fig. 4 from Fukui et al., 2014

Phenotype

Phenotype resulting from MO1-yap1

Phenotype	Fish	Figures
cardiac muscle progenitor cell migration to the midline involved in heart field formation decreased occurrence, abnormal	ha01Tg; ncv11Tg + MO1-yap1	Fig. 1 , Fig. 2 , Fig. 3 from Fukui et al., 2014
determination of heart left/right asymmetry disrupted, abnormal	AB/TU + MO1-yap1	Figure 1 from Fillatre et al., 2019
endoderm cellular quality, abnormal	ha01Tg + MO1-yap1	Fig. 4 from Fukui et al., 2014
endoderm anterior region apoptotic, abnormal	ha01Tg + MO1-yap1	Fig. 3 from Fukui et al., 2014
endoderm antero-medial region decreased object quality, abnormal	ha01Tg; ncv11Tg + MO1-yap1	Fig. 2 from Fukui et al., 2014
endoderm apoptotic process increased occurrence, abnormal	ha01Tg + MO1-yap1	Fig. 3 from Fukui et al., 2014
eye decreased size, abnormal	mw50Tg + MO1-yap1 + MO4-tp53	Fig. 4 from Miesfeld et al., 2014
heart d2EGFP expression decreased amount, abnormal	mw50Tg + MO1-yap1 + MO4-tp53	Fig. 4 from Miesfeld et al., 2014
heart malformed, abnormal	ncv10Tg + MO1-yap1	Fig. 1 from Fukui et al., 2014
heart split bilaterally, abnormal	ncv10Tg + MO1-yap1	Fig. 1 from Fukui et al., 2014
heart jogging process quality, abnormal	AB/TU + MO1-yap1	Figure 1 from Fillatre et al., 2019
heart morphogenesis decreased process quality, abnormal	ncv10Tg + MO1-yap1	Fig. 1 , Fig. 2 , Fig. 3 from Fukui et al., 2014
heart tube mislocalised, abnormal	AB/TU + MO1-yap1	Figure 1 from Fillatre et al., 2019
heart tube split bilaterally, abnormal	ha01Tg; ncv11Tg + MO1-yap1	Fig. 1 , Fig. 2 , Fig. 3 from Fukui et al., 2014
myocardial precursor mislocalised laterally, abnormal	ha01Tg; ncv11Tg + MO1-yap1	Fig. 1 , Fig. 2 from Fukui et al., 2014
pancreas development disrupted, abnormal	WT + MO1-yap1	Fig. 7 from Cebola et al., 2015
pancreatic bud decreased size, abnormal	WT + MO1-yap1	Fig. 7 from Cebola et al., 2015
pancreatic bud lacks parts or has fewer parts of type cell, abnormal	WT + MO1-yap1	Fig. 7 from Cebola et al., 2015
pharyngeal endoderm mislocalised laterally, abnormal	AB + MO1-yap1	Fig. 2 from Fukui et al., 2014
posterior lateral line primordium has fewer parts of type posterior lateral line primordium cell, abnormal	zf106Tg + MO1-yap1	Fig. 5 , Fig. 6 from Agarwala et al., 2015
posterior pancreatic bud decreased size, abnormal	WT + MO1-yap1	Fig. S7 from Cebola et al., 2015
pronephros cystic, abnormal	WT + MO1-yap1	Fig. 3 from Skouloudaki et al., 2009
retinal pigmented epithelium d2EGFP expression decreased amount, abnormal	mw50Tg + MO1-yap1 + MO4-tp53	Fig. 4 from Miesfeld et al., 2014
trunk musculature striated muscle cell d2EGFP expression decreased amount, abnormal	mw50Tg + MO1-yap1 + MO4-tp53	Fig. 4 from Miesfeld et al., 2014
whole organism has extra parts of type posterior pancreatic bud, abnormal	WT + MO1-yap1	Fig. S7 from Cebola et al., 2015

Phenotype of all Fish created by or utilizing MO1-yap1

Phenotype	Fish	Conditions	Figures
myocardial precursor mislocalised laterally, abnormal	AB + MO1-yap1	standard conditions	Fig. 1 from Fukui et al., 2014
endoderm cellular quality, abnormal	AB + MO1-yap1	standard conditions	Fig. 4 from Fukui et al., 2014
cardiac muscle progenitor cell migration to the midline involved in heart field formation decreased occurrence, abnormal	AB + MO1-yap1	standard conditions	Fig. 1 from Fukui et al., 2014
pharyngeal endoderm mislocalised laterally, abnormal	AB + MO1-yap1	standard conditions	Fig. 2 from Fukui et al., 2014
heart tube split bilaterally, abnormal	AB + MO1-yap1	standard conditions	Fig. 1 from Fukui et al., 2014
heart tube mislocalised, abnormal	AB/TU + MO1-yap1	standard conditions	Figure 1 from Fillatre et al., 2019
determination of heart left/right asymmetry disrupted, abnormal	AB/TU + MO1-yap1	standard conditions	Figure 1 from Fillatre et al., 2019
heart jogging process quality, abnormal	AB/TU + MO1-yap1	standard conditions	Figure 1 from Fillatre et al., 2019
pancreatic bud lacks parts or has fewer parts of type cell, abnormal	WT + MO1-yap1	standard conditions	Fig. 7 from Cebola et al., 2015
posterior pancreatic bud decreased size, abnormal	WT + MO1-yap1	control	Fig. S7 from Cebola et al., 2015
pancreatic bud decreased size, abnormal	WT + MO1-yap1	standard conditions	Fig. 7 from Cebola et al., 2015
pancreas development disrupted, abnormal	WT + MO1-yap1	standard conditions	Fig. 7 from Cebola et al., 2015
whole organism has extra parts of type posterior pancreatic bud, abnormal	WT + MO1-yap1	control	Fig. S7 from Cebola et al., 2015
pronephros cystic, abnormal	WT + MO1-yap1	standard conditions	Fig. 3 from Skouloudaki et al., 2009
cardiac muscle progenitor cell migration to the midline involved in heart field formation decreased occurrence, abnormal	ha01Tg + MO1-yap1	standard conditions	Fig. 3 from Fukui et al., 2014
heart tube split bilaterally, abnormal	ha01Tg + MO1-yap1	standard conditions	Fig. 3 from Fukui et al., 2014
endoderm cellular quality, abnormal	ha01Tg + MO1-yap1	standard conditions	Fig. 4 from Fukui et al., 2014
endoderm anterior region apoptotic, abnormal	ha01Tg + MO1-yap1	standard conditions	Fig. 3 from Fukui et al., 2014
endoderm apoptotic process increased occurrence, abnormal	ha01Tg + MO1-yap1	standard conditions	Fig. 3 from Fukui et al., 2014
heart morphogenesis decreased process quality, abnormal	ha01Tg + MO1-yap1	standard conditions	Fig. 3 from Fukui et al., 2014
trunk musculature striated muscle cell d2EGFP expression decreased amount, abnormal	mw50Tg + MO1-yap1 + MO4-tp53	standard conditions	Fig. 4 from Miesfeld et al., 2014
retinal pigmented epithelium d2EGFP expression decreased amount, abnormal	mw50Tg + MO1-yap1 + MO4-tp53	standard conditions	Fig. 4 from Miesfeld et al., 2014
eye decreased size, abnormal	mw50Tg + MO1-yap1 + MO4-tp53	standard conditions	Fig. 4 from Miesfeld et al., 2014
heart d2EGFP expression decreased amount, abnormal	mw50Tg + MO1-yap1 + MO4-tp53	standard conditions	Fig. 4 from Miesfeld et al., 2014
heart split bilaterally, abnormal	ncv10Tg + MO1-yap1	standard conditions	Fig. 1 from Fukui et al., 2014
heart morphogenesis decreased process quality, abnormal	ncv10Tg + MO1-yap1	standard conditions	Fig. 1 from Fukui et al., 2014
heart malformed, abnormal	ncv10Tg + MO1-yap1	standard conditions	Fig. 1 from Fukui et al., 2014
posterior lateral line primordium has fewer parts of type posterior lateral line primordium cell, abnormal	zf106Tg + MO1-yap1	standard conditions	Fig. 5 , Fig. 6 from Agarwala et al., 2015
endoderm antero-medial region decreased object quality, abnormal	ha01Tg; ncv11Tg + MO1-yap1	standard conditions	Fig. 2 from Fukui et al., 2014
heart morphogenesis decreased process quality, abnormal	ha01Tg; ncv11Tg + MO1-yap1	standard conditions	Fig. 2 from Fukui et al., 2014
heart tube split bilaterally, abnormal	ha01Tg; ncv11Tg + MO1-yap1	standard conditions	Fig. 2 from Fukui et al., 2014
cardiac muscle progenitor cell migration to the midline involved in heart field formation decreased occurrence, abnormal	ha01Tg; ncv11Tg + MO1-yap1	standard conditions	Fig. 2 from Fukui et al., 2014
myocardial precursor mislocalised laterally, abnormal	ha01Tg; ncv11Tg + MO1-yap1	standard conditions	Fig. 2 from Fukui et al., 2014
Kupffer's vesicle motile cilium decreased length, abnormal	AB/TU + MO1-yap1 + MO4-wwtr1	standard conditions	Figure 3 from Fillatre et al., 2019
heart tube mislocalised, abnormal	AB/TU + MO1-yap1 + MO4-wwtr1	standard conditions	Figure 1 from Fillatre et al., 2019
determination of heart left/right asymmetry disrupted, exacerbated	AB/TU + MO1-yap1 + MO4-wwtr1	standard conditions	Figure 1 from Fillatre et al., 2019
forerunner cell group decreased amount, abnormal	AB/TU + MO1-yap1 + MO4-wwtr1	standard conditions	Figure 2 from Fillatre et al., 2019
heart jogging process quality, abnormal	AB/TU + MO1-yap1 + MO4-wwtr1	standard conditions	Figure 1 from Fillatre et al., 2019
Kupffer's vesicle decreased size, abnormal	AB/TU + MO1-yap1 + MO4-wwtr1	standard conditions	Figure 2 from Fillatre et al., 2019
forerunner cell group apoptotic process increased occurrence, abnormal	AB/TU + MO1-yap1 + MO4-wwtr1	standard conditions	Figure 2 from Fillatre et al., 2019
posterior lateral line primordium has number of posterior lateral line primordium cell, ameliorated	zf106Tg + MO1-amotl2a + MO1-yap1	standard conditions	Fig. 6 from Agarwala et al., 2015
posterior lateral line primordium cell population proliferation occurrence, ameliorated	zf106Tg + MO1-amotl2a + MO1-yap1	standard conditions	Fig. 6 from Agarwala et al., 2015
heart split bilaterally, abnormal	ha01Tg; ncv11Tg + MO1-yap1 + MO3-ccn2a	standard conditions	Fig. 4 from Fukui et al., 2014
myocardial precursor mislocalised laterally, abnormal	ha01Tg; ncv11Tg + MO1-yap1 + MO3-ccn2a	standard conditions	Fig. 4 from Fukui et al., 2014
heart morphogenesis decreased process quality, abnormal	ha01Tg; ncv11Tg + MO1-yap1 + MO3-ccn2a	standard conditions	Fig. 4 from Fukui et al., 2014
cardiac muscle progenitor cell migration to the midline involved in heart field formation decreased occurrence, abnormal	ha01Tg; ncv11Tg + MO1-yap1 + MO3-ccn2a	standard conditions	Fig. 4 from Fukui et al., 2014
endoderm antero-medial region decreased object quality, abnormal	ha01Tg; ncv11Tg + MO1-yap1 + MO3-ccn2a	standard conditions	Fig. 4 from Fukui et al., 2014
rhombomere cell population proliferation decreased occurrence, abnormal	wwtr1^fu55/+; mw50Tg + MO1-yap1 + MO4-tp53	control	Fig. 5 from Voltes et al., 2019
endoderm antero-medial region decreased object quality, abnormal	ha01Tg; ncv11Tg + MO1-gna13a + MO1-gna13b + MO1-yap1 + MO3-ccn2a	standard conditions	Fig. 2 from Fukui et al., 2014
heart morphogenesis decreased process quality, abnormal	ha01Tg; ncv11Tg + MO1-gna13a + MO1-gna13b + MO1-yap1 + MO3-ccn2a	standard conditions	Fig. 2 from Fukui et al., 2014
heart tube split bilaterally, abnormal	ha01Tg; ncv11Tg + MO1-gna13a + MO1-gna13b + MO1-yap1 + MO3-ccn2a	standard conditions	Fig. 2 from Fukui et al., 2014
myocardial precursor mislocalised laterally, abnormal	ha01Tg; ncv11Tg + MO1-gna13a + MO1-gna13b + MO1-yap1 + MO3-ccn2a	standard conditions	Fig. 2 from Fukui et al., 2014
cardiac muscle progenitor cell migration to the midline involved in heart field formation decreased occurrence, abnormal	ha01Tg; ncv11Tg + MO1-gna13a + MO1-gna13b + MO1-yap1 + MO3-ccn2a	standard conditions	Fig. 2 from Fukui et al., 2014

Citations