Morpholino
MO2-foxj1a
- ID
- ZDB-MRPHLNO-090409-2
- Name
- MO2-foxj1a
- Previous Names
- None
- Target
- Sequence
-
5' - CATGGAACTCATGGAGAGCATGGTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
translation inhibitory morpholino
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-foxj1a
Expressed Gene | Anatomy | Figures |
---|---|---|
cetn4 |
|
Fig. 3
from Yu et al., 2008 |
dnah9 |
|
Fig. 3
from Yu et al., 2008 |
nkx2.9 |
Fig. S3
from Yu et al., 2008 |
|
pax2a |
Fig. S3
from Yu et al., 2008 |
|
rfx2 |
Fig. S6
from Yu et al., 2008 |
1 - 5 of 8 Show all
Phenotype
Phenotype resulting from MO2-foxj1a
1 - 5 of 13 Show all
Phenotype of all Fish created by or utilizing MO2-foxj1a
1 - 5 of 15 Show all
Citations
- Szenker-Ravi, E., Ott, T., Khatoo, M., de Bellaing, A.M., Goh, W.X., Chong, Y.L., Beckers, A., Kannesan, D., Louvel, G., Anujan, P., Ravi, V., Bonnard, C., Moutton, S., Schoen, P., Fradin, M., Colin, E., Megarbane, A., Daou, L., Chehab, G., Di Filippo, S., Rooryck, C., Deleuze, J.F., Boland, A., Arribard, N., Eker, R., Tohari, S., Ng, A.Y., Rio, M., Lim, C.T., Eisenhaber, B., Eisenhaber, F., Venkatesh, B., Amiel, J., Crollius, H.R., Gordon, C.T., Gossler, A., Roy, S., Attie-Bitach, T., Blum, M., Bouvagnet, P., Reversade, B. (2021) Discovery of a genetic module essential for assigning left-right asymmetry in humans and ancestral vertebrates. Nature Genetics. 54(1):62-72
- Ribeiro, A., Monteiro, J.F., Certal, A.C., Cristovão, A.M., Saúde, L. (2017) Foxj1a is expressed in ependymal precursors, controls central canal position and is activated in new ependymal cells during regeneration in zebrafish. Open Biology. 7(11)
- Dutta, S., Sriskanda, S., Boobalan, E., Alur, R.P., Elkahloun, A., Brooks, B.P. (2015) nlz1 Is required for cilia formation in zebrafish embryogenesis. Developmental Biology. 406(2):203-11
- Lu, H., Toh, M.T., Narasimhan, V., Thamilselvam, S.K., Choksi, S.P., Roy, S. (2015) A function for the Joubert syndrome protein Arl13b in ciliary membrane extension and ciliary length regulation. Developmental Biology. 397(2):225-36
- Yu, X., Ng, C.P., Habacher, H., and Roy, S. (2008) Foxj1 transcription factors are master regulators of the motile ciliogenic program. Nature Genetics. 40(12):1445-1453
1 - 5 of 5
Show