Morpholino

MO2-anos1a

ID
ZDB-MRPHLNO-081216-1
Name
MO2-anos1a
Previous Names
None
Target
Sequence
5' - GGTGAGCCCGTCTCGCATCTTGAAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
translation-blocker, note possible typo in published sequence at position 13 - the following version is a better match to known sequences 5'- GGTGAGCCCGTCGCGCATCTTGAAG -3'
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-anos1a
Expressed Gene Anatomy Figures
anos1a Fig. 2 with image from Yanicostas et al., 2008
cxcr4b Fig. 3 with image from Yanicostas et al., 2008
epcam Fig. 2 with image from Yanicostas et al., 2008
gad1b Fig. 5 with image from Yanicostas et al., 2009
Phenotype
Phenotype resulting from MO2-anos1a
Phenotype Fish Figures
anterior lateral line neuromast decreased amount, abnormal WT + MO2-anos1a text only from Yanicostas et al., 2008
axon guidance disrupted, abnormal AB + MO2-anos1a Fig. 2 with image,  Fig. 4 with image from Yanicostas et al., 2009
fasciculation of sensory neuron axon disrupted, abnormal jt0012Tg + MO2-anos1a Fig. 2 with image from Yanicostas et al., 2009
glomerular layer aplastic, abnormal AB + MO2-anos1a Fig. 4 with image from Yanicostas et al., 2009
innervation disrupted, abnormal jt0012Tg + MO2-anos1a Fig. 2 with image from Yanicostas et al., 2009
neuromast hair cell decreased amount, abnormal WT + MO2-anos1a Fig. 2 with image from Yanicostas et al., 2008
neuromast primordium migration delayed, abnormal zf106Tg + MO2-anos1a Fig. 3 with image,  Fig. 5 with image,  Fig. S5 with image from Yanicostas et al., 2008
olfactory bulb disorganized, abnormal jt0012Tg + MO2-anos1a Fig. 2 with image from Yanicostas et al., 2009
olfactory bulb dopaminergic neuron decreased amount, abnormal AB + MO2-anos1a Fig. 6 with image from Yanicostas et al., 2009
olfactory bulb GABAergic neuron decreased amount, abnormal AB + MO2-anos1a Fig. 5 with image from Yanicostas et al., 2009
olfactory bulb development disrupted, abnormal AB + MO2-anos1a Fig. 2 with image,  Fig. 4 with image from Yanicostas et al., 2009
olfactory epithelium disorganized, abnormal jt0012Tg + MO2-anos1a Fig. 2 with image from Yanicostas et al., 2009
olfactory epithelium split, abnormal jt0012Tg + MO2-anos1a Fig. 2 with image from Yanicostas et al., 2009
olfactory placode disorganized, abnormal jt0012Tg + MO2-anos1a Fig. 2 with image from Yanicostas et al., 2009
olfactory receptor cell spatial pattern, abnormal jt0012Tg + MO2-anos1a Fig. 2 with image from Yanicostas et al., 2009
olfactory receptor cell axon decreased length, abnormal jt0012Tg + MO2-anos1a Fig. 2 with image from Yanicostas et al., 2009
olfactory receptor cell axon disorganized, abnormal AB + MO2-anos1a Fig. 3 with image,  Fig. 4 with image from Yanicostas et al., 2009
posterior lateral line nerve decreased length, abnormal zf106Tg + MO2-anos1a Fig. S4 with image,  Fig. S5 with image from Yanicostas et al., 2008
posterior lateral line nerve development disrupted, abnormal zf106Tg + MO2-anos1a Fig. S4 with image,  Fig. S5 with image from Yanicostas et al., 2008
posterior lateral line neuromast decreased amount, abnormal WT + MO2-anos1a Fig. 2 with image from Yanicostas et al., 2008
posterior lateral line neuromast malformed, abnormal WT + MO2-anos1a Fig. 2 with image from Yanicostas et al., 2008
posterior lateral line primordium circular, abnormal zf106Tg + MO2-anos1a Fig. 4 with image from Yanicostas et al., 2008
posterior lateral line primordium crescent-shaped, abnormal zf106Tg + MO2-anos1a Fig. 4 with image from Yanicostas et al., 2008
Phenotype of all Fish created by or utilizing MO2-anos1a
Phenotype Fish Conditions Figures
olfactory bulb development disrupted, abnormal AB + MO2-anos1a standard conditions Fig. 4 with image from Yanicostas et al., 2009
axon guidance disrupted, abnormal AB + MO2-anos1a standard conditions Fig. 4 with image from Yanicostas et al., 2009
olfactory receptor cell axon disorganized, abnormal AB + MO2-anos1a standard conditions Fig. 4 with image from Yanicostas et al., 2009
olfactory bulb dopaminergic neuron decreased amount, abnormal AB + MO2-anos1a standard conditions Fig. 6 with image from Yanicostas et al., 2009
olfactory bulb GABAergic neuron decreased amount, abnormal AB + MO2-anos1a standard conditions Fig. 5 with image from Yanicostas et al., 2009
glomerular layer aplastic, abnormal AB + MO2-anos1a standard conditions Fig. 4 with image from Yanicostas et al., 2009
neuromast primordium migration delayed, abnormal WT + MO2-anos1a standard conditions Fig. 3 with image from Yanicostas et al., 2008
posterior lateral line neuromast decreased amount, abnormal WT + MO2-anos1a standard conditions Fig. 2 with image from Yanicostas et al., 2008
posterior lateral line neuromast malformed, abnormal WT + MO2-anos1a standard conditions Fig. 2 with image from Yanicostas et al., 2008
anterior lateral line neuromast decreased amount, abnormal WT + MO2-anos1a standard conditions text only from Yanicostas et al., 2008
neuromast hair cell decreased amount, abnormal WT + MO2-anos1a standard conditions Fig. 2 with image from Yanicostas et al., 2008
axon guidance disrupted, abnormal jt0012Tg + MO2-anos1a standard conditions Fig. 2 with image from Yanicostas et al., 2009
olfactory receptor cell axon disorganized, abnormal jt0012Tg + MO2-anos1a standard conditions Fig. 3 with image from Yanicostas et al., 2009
olfactory placode disorganized, abnormal jt0012Tg + MO2-anos1a standard conditions Fig. 2 with image from Yanicostas et al., 2009
olfactory epithelium split, abnormal jt0012Tg + MO2-anos1a standard conditions Fig. 2 with image from Yanicostas et al., 2009
olfactory bulb development disrupted, abnormal jt0012Tg + MO2-anos1a standard conditions Fig. 2 with image from Yanicostas et al., 2009
olfactory bulb disorganized, abnormal jt0012Tg + MO2-anos1a standard conditions Fig. 2 with image from Yanicostas et al., 2009
olfactory epithelium disorganized, abnormal jt0012Tg + MO2-anos1a standard conditions Fig. 2 with image from Yanicostas et al., 2009
innervation disrupted, abnormal jt0012Tg + MO2-anos1a standard conditions Fig. 2 with image from Yanicostas et al., 2009
fasciculation of sensory neuron axon disrupted, abnormal jt0012Tg + MO2-anos1a standard conditions Fig. 2 with image from Yanicostas et al., 2009
olfactory receptor cell spatial pattern, abnormal jt0012Tg + MO2-anos1a standard conditions Fig. 2 with image from Yanicostas et al., 2009
olfactory receptor cell axon decreased length, abnormal jt0012Tg + MO2-anos1a standard conditions Fig. 2 with image from Yanicostas et al., 2009
posterior lateral line nerve decreased length, abnormal kca66Tg + MO2-anos1a standard conditions Fig. S4 with image from Yanicostas et al., 2008
neuromast primordium migration delayed, abnormal kca66Tg + MO2-anos1a standard conditions Fig. 5 with image from Yanicostas et al., 2008
posterior lateral line nerve development disrupted, abnormal kca66Tg + MO2-anos1a standard conditions Fig. S4 with image from Yanicostas et al., 2008
posterior lateral line nerve development disrupted, abnormal zf106Tg + MO2-anos1a standard conditions Fig. S5 with image from Yanicostas et al., 2008
posterior lateral line primordium crescent-shaped, abnormal zf106Tg + MO2-anos1a standard conditions Fig. 4 with image from Yanicostas et al., 2008
neuromast primordium migration delayed, abnormal zf106Tg + MO2-anos1a standard conditions Fig. 5 with image,  Fig. S5 with image from Yanicostas et al., 2008
posterior lateral line primordium circular, abnormal zf106Tg + MO2-anos1a standard conditions Fig. 4 with image from Yanicostas et al., 2008
posterior lateral line nerve decreased length, abnormal zf106Tg + MO2-anos1a standard conditions Fig. S5 with image from Yanicostas et al., 2008
neuromast primordium migration delayed, abnormal zf106Tg + MO2-anos1a + MO2-cxcl12a standard conditions Fig. 7 with image from Yanicostas et al., 2008
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.