Morpholino

MO2-itga7

ID

ZDB-MRPHLNO-080930-2

Name

MO2-itga7

Previous Names

integrin a7-splice MO (1)

Target

itga7 (1)

Sequence

5' - CTCAGATCAGTGCAGACTCACCAGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-itga7

Expressed Gene	Anatomy	Figures
itga7	whole organism	Fig. S4 from Postel et al., 2008
pxna	myotome muscle tendon junction vertical myoseptum	Fig. 7 from Goody et al., 2012

Phenotype

Phenotype resulting from MO2-itga7

Phenotype	Fish	Figures
locomotion involved in locomotory behavior decreased rate, abnormal	WT + MO2-itga7	Fig. 8 from Goody et al., 2012
myotome muscle cell detached from myotome muscle tendon junction, abnormal	WT + MO2-itga7	Fig. 3 , Fig. 7 from Goody et al., 2012
skeletal muscle cell actin cytoskeleton retracted, abnormal	WT + MO2-itga7	Fig. 3 from Postel et al., 2008
whole organism paralysed, abnormal	WT + MO2-itga7	Fig. 3 from Postel et al., 2008

Phenotype of all Fish created by or utilizing MO2-itga7

Phenotype	Fish	Conditions	Figures
whole organism paralysed, abnormal	WT + MO2-itga7	standard conditions	Fig. 3 from Postel et al., 2008
locomotion involved in locomotory behavior decreased rate, abnormal	WT + MO2-itga7	standard conditions	Fig. 8 from Goody et al., 2012
skeletal muscle cell actin cytoskeleton retracted, abnormal	WT + MO2-itga7	standard conditions	Fig. 3 from Postel et al., 2008
myotome muscle cell detached from myotome muscle tendon junction, abnormal	WT + MO2-itga7	standard conditions	Fig. 3 , Fig. 7 from Goody et al., 2012
locomotion involved in locomotory behavior decreased rate, abnormal	WT + MO2-itga7	chemical treatment: NAD(+)	Fig. 8 from Goody et al., 2012
myotome muscle cell degenerate, abnormal	WT + MO1-dag1 + MO2-itga7	chemical treatment: NAD(+)	Fig. 3 from Goody et al., 2012
myotome muscle cell degenerate, abnormal	WT + MO1-dag1 + MO2-itga7	standard conditions	Fig. 3 from Goody et al., 2012
myotome muscle tendon junction malformed, abnormal	WT + MO1-dag1 + MO2-itga7	chemical treatment: NAD(+)	Fig. 3 from Goody et al., 2012
vertical myoseptum malformed, abnormal	WT + MO1-dag1 + MO2-itga7	standard conditions	Fig. 3 from Goody et al., 2012
myotome muscle cell detached from myotome muscle tendon junction, abnormal	WT + MO1-dag1 + MO2-itga7	standard conditions	Fig. 3 from Goody et al., 2012
vertical myoseptum malformed, abnormal	WT + MO1-dag1 + MO2-itga7	chemical treatment: NAD(+)	Fig. 3 from Goody et al., 2012
myotome muscle tendon junction malformed, abnormal	WT + MO1-dag1 + MO2-itga7	standard conditions	Fig. 3 from Goody et al., 2012
myotome muscle cell detached from myotome muscle tendon junction, abnormal	WT + MO1-dag1 + MO2-itga7	chemical treatment: NAD(+)	Fig. 3 from Goody et al., 2012
myotome muscle cell detached from myotome muscle tendon junction, abnormal	mai1Tg + MO2-itga7	standard conditions	Fig. 7 from Goody et al., 2012
locomotion involved in locomotory behavior decreased rate, abnormal	mai1Tg + MO2-itga7	standard conditions	Fig. 8 from Goody et al., 2012
skeletal muscle cell sarcolemma retracted, abnormal	vu119Tg + MO2-itga7	standard conditions	Fig. S5 from Postel et al., 2008
skeletal muscle cell actin cytoskeleton retracted, abnormal	vu119Tg + MO2-itga7	standard conditions	Fig. S5 from Postel et al., 2008

Citations