Morpholino

MO1-desi2

ID

ZDB-MRPHLNO-080912-1

Name

MO1-desi2

Previous Names

MO1-fam152a
MO1-pppde1
ZPnas4-MO (1)

Target

desi2 (1)

Sequence

5' - CAGGATAACCGGCTCGTTTGCCATC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-desi2

Expressed Gene	Anatomy	Figures
ctslb	polster	Fig. 5 from Yao et al., 2008
dlx3b	neural plate	Fig. 5 from Yao et al., 2008
gsc	prechordal plate	Fig. 5 from Yao et al., 2008
myod1	paraxial mesoderm	Fig. 5 from Yao et al., 2008
pcdh8	lateral mesoderm	Fig. 5 from Yao et al., 2008
tbxta	axial mesoderm	Fig. 5 from Yao et al., 2008

Phenotype

Phenotype resulting from MO1-desi2

Phenotype	Fish	Figures
axis decreased length, abnormal	TU + MO1-desi2	Fig. 3, Fig. 5 from Yao et al., 2008
axis increased width, abnormal	TU + MO1-desi2	Fig. 3 from Yao et al., 2008
convergent extension involved in gastrulation disrupted, abnormal	TU + MO1-desi2	Fig. 5 from Yao et al., 2008
gastrulation disrupted, abnormal	TU + MO1-desi2	Fig. 3, Fig. 5 from Yao et al., 2008
neural plate increased width, abnormal	TU + MO1-desi2	Fig. 5 from Yao et al., 2008
polster mislocalised, abnormal	TU + MO1-desi2	Fig. 5 from Yao et al., 2008
post-anal tail morphogenesis disrupted, abnormal	TU + MO1-desi2	Fig. 3 from Yao et al., 2008
post-vent region curved ventral, abnormal	TU + MO1-desi2	Fig. 3 from Yao et al., 2008
post-vent region decreased length, abnormal	TU + MO1-desi2	Fig. 3 from Yao et al., 2008
prechordal plate mislocalised, abnormal	TU + MO1-desi2	Fig. 3, Fig. 5 from Yao et al., 2008

Phenotype of all Fish created by or utilizing MO1-desi2

Phenotype	Fish	Conditions	Figures
prechordal plate mislocalised, abnormal	TU + MO1-desi2	standard conditions	Fig. 3, Fig. 5 from Yao et al., 2008
post-vent region curved ventral, abnormal	TU + MO1-desi2	standard conditions	Fig. 3 from Yao et al., 2008
polster mislocalised, abnormal	TU + MO1-desi2	standard conditions	Fig. 5 from Yao et al., 2008
post-vent region decreased length, abnormal	TU + MO1-desi2	standard conditions	Fig. 3 from Yao et al., 2008
axis increased width, abnormal	TU + MO1-desi2	standard conditions	Fig. 3 from Yao et al., 2008
convergent extension involved in gastrulation disrupted, abnormal	TU + MO1-desi2	standard conditions	Fig. 5 from Yao et al., 2008
axis decreased length, abnormal	TU + MO1-desi2	standard conditions	Fig. 3, Fig. 5 from Yao et al., 2008
post-anal tail morphogenesis disrupted, abnormal	TU + MO1-desi2	standard conditions	Fig. 3 from Yao et al., 2008
gastrulation disrupted, abnormal	TU + MO1-desi2	standard conditions	Fig. 3, Fig. 5 from Yao et al., 2008
neural plate increased width, abnormal	TU + MO1-desi2	standard conditions	Fig. 5 from Yao et al., 2008
post-anal tail morphogenesis disrupted, abnormal	TU + MO1-desi2 + MO2-wnt11f2	standard conditions	Fig. 7 from Yao et al., 2008
notochord increased width, abnormal	TU + MO1-desi2 + MO2-wnt11f2	standard conditions	Fig. 7 from Yao et al., 2008
axis decreased length, abnormal	TU + MO1-desi2 + MO2-wnt11f2	standard conditions	Fig. 7 from Yao et al., 2008
convergent extension involved in gastrulation disrupted, abnormal	TU + MO1-desi2 + MO2-wnt11f2	standard conditions	Fig. 7 from Yao et al., 2008
convergent extension involved in axis elongation disrupted, abnormal	TU + MO1-desi2 + MO2-wnt11f2	standard conditions	Fig. 7 from Yao et al., 2008
post-vent region decreased length, abnormal	TU + MO1-desi2 + MO2-wnt11f2	standard conditions	Fig. 7 from Yao et al., 2008
gastrulation disrupted, abnormal	TU + MO1-desi2 + MO2-wnt11f2	standard conditions	Fig. 7 from Yao et al., 2008

Citations