Morpholino

MO1-egfl7

ID
ZDB-MRPHLNO-080723-1
Name
MO1-egfl7
Previous Names
  • AS-47
Target
Sequence
5' - CAGGTGTGTCTGACAGCAGAAAGAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-egfl7
Phenotype
Phenotype resulting from MO1-egfl7
Phenotype Fish Figures
axial vasculature decreased area, abnormal s843Tg + MO1-egfl7 Fig. 5 with image from De Mazière et al., 2008
blood vessel endothelial cell mislocalised, abnormal WT + MO1-egfl7 Fig. 1 from Schmidt et al., 2007
blood vessel endothelial cell bicellular tight junction increased amount, abnormal s843Tg + MO1-egfl7 Fig. 6 with imageFig. 7 with image from De Mazière et al., 2008
blood vessel endothelial cell bicellular tight junction mislocalised, abnormal s843Tg + MO1-egfl7 Fig. 6 with imageFig. 7 with image from De Mazière et al., 2008
blood vessel endothelial cell migration disrupted, abnormal WT + MO1-egfl7 Fig. 1 from Schmidt et al., 2007
cellular response to stress increased process quality, abnormal AB + MO1-egfl7 Fig. 4 from Lai et al., 2019
dorsal aorta mislocalised dorsally, abnormal s843Tg + MO1-egfl7 Fig. 5 with image from De Mazière et al., 2008
dorsal aorta obstructed, abnormal s843Tg + MO1-egfl7 Fig. 6 with image from De Mazière et al., 2008
dorsal aorta unlumenized, abnormal s843Tg + MO1-egfl7 Fig. 5 with image from De Mazière et al., 2008
dorsal aorta blood vessel endothelial cell positional polarity, abnormal s843Tg + MO1-egfl7 Fig. 6 with image from De Mazière et al., 2008
establishment or maintenance of epithelial cell apical/basal polarity disrupted, abnormal s843Tg + MO1-egfl7 Fig. 5 with imageFig. 6 with image from De Mazière et al., 2008
intersegmental vessel morphology, abnormal s843Tg + MO1-egfl7 Fig. 2 from Rossi et al., 2015
intersegmental vessel morphology, ameliorated egfl7s981/+; s843Tg + MO1-egfl7 Fig. 2 from Rossi et al., 2015
pericardium edematous, abnormal s843Tg + MO1-egfl7 Fig. 2 from Rossi et al., 2015
posterior cardinal vein deformed, abnormal s843Tg + MO1-egfl7 Fig. 5 with image from De Mazière et al., 2008
posterior cardinal vein duplicated, abnormal s843Tg + MO1-egfl7 Fig. 7 with image from De Mazière et al., 2008
posterior cardinal vein mislocalised dorsally, abnormal s843Tg + MO1-egfl7 Fig. 5 with image from De Mazière et al., 2008
posterior cardinal vein morphology, abnormal WT + MO1-egfl7 Fig. 1 from Schmidt et al., 2007
posterior cardinal vein blood vessel endothelial cell structure, abnormal s843Tg + MO1-egfl7 Fig. 7 with image from De Mazière et al., 2008
ventral wall of dorsal aorta deformed, abnormal s843Tg + MO1-egfl7 text only from De Mazière et al., 2008
whole organism isg15 expression increased amount, abnormal AB + MO1-egfl7 Fig. 4 from Lai et al., 2019
whole organism isg20 expression increased amount, abnormal AB + MO1-egfl7 Fig. 4 from Lai et al., 2019
whole organism casp8 expression increased amount, abnormal AB + MO1-egfl7 Fig. 4 from Lai et al., 2019
whole organism tp53 expression increased amount, abnormal WT + MO1-egfl7 Fig. 4 from Lai et al., 2019
Fig. S5 from Rossi et al., 2015
whole organism phlda3 expression increased amount, abnormal AB + MO1-egfl7 Fig. 4 from Lai et al., 2019
Phenotype of all Fish created by or utilizing MO1-egfl7
Phenotype Fish Conditions Figures
whole organism casp8 expression increased amount, abnormal AB + MO1-egfl7 standard conditions Fig. 4 from Lai et al., 2019
whole organism phlda3 expression increased amount, abnormal AB + MO1-egfl7 standard conditions Fig. 4 from Lai et al., 2019
whole organism isg20 expression increased amount, abnormal AB + MO1-egfl7 standard conditions Fig. 4 from Lai et al., 2019
whole organism tp53 expression increased amount, abnormal AB + MO1-egfl7 standard conditions Fig. 4 from Lai et al., 2019
cellular response to stress increased process quality, abnormal AB + MO1-egfl7 standard conditions Fig. 4 from Lai et al., 2019
whole organism isg15 expression increased amount, abnormal AB + MO1-egfl7 standard conditions Fig. 4 from Lai et al., 2019
posterior cardinal vein morphology, abnormal WT + MO1-egfl7 standard conditions Fig. 1 from Schmidt et al., 2007
whole organism tp53 expression increased amount, abnormal WT + MO1-egfl7 standard conditions Fig. S5 from Rossi et al., 2015
blood vessel endothelial cell migration disrupted, abnormal WT + MO1-egfl7 standard conditions Fig. 1 from Schmidt et al., 2007
blood vessel endothelial cell mislocalised, abnormal WT + MO1-egfl7 standard conditions Fig. 1 from Schmidt et al., 2007
dorsal aorta unlumenized, abnormal s843Tg + MO1-egfl7 standard conditions Fig. 5 with image from De Mazière et al., 2008
ventral wall of dorsal aorta deformed, abnormal s843Tg + MO1-egfl7 standard conditions text only from De Mazière et al., 2008
posterior cardinal vein duplicated, abnormal s843Tg + MO1-egfl7 standard conditions Fig. 7 with image from De Mazière et al., 2008
blood vessel endothelial cell bicellular tight junction mislocalised, abnormal s843Tg + MO1-egfl7 standard conditions Fig. 6 with imageFig. 7 with image from De Mazière et al., 2008
pericardium edematous, abnormal s843Tg + MO1-egfl7 standard conditions Fig. 2 from Rossi et al., 2015
dorsal aorta mislocalised dorsally, abnormal s843Tg + MO1-egfl7 standard conditions Fig. 5 with image from De Mazière et al., 2008
posterior cardinal vein deformed, abnormal s843Tg + MO1-egfl7 standard conditions Fig. 5 with image from De Mazière et al., 2008
axial vasculature decreased area, abnormal s843Tg + MO1-egfl7 standard conditions Fig. 5 with image from De Mazière et al., 2008
posterior cardinal vein mislocalised dorsally, abnormal s843Tg + MO1-egfl7 standard conditions Fig. 5 with image from De Mazière et al., 2008
posterior cardinal vein blood vessel endothelial cell structure, abnormal s843Tg + MO1-egfl7 standard conditions Fig. 7 with image from De Mazière et al., 2008
blood vessel endothelial cell bicellular tight junction increased amount, abnormal s843Tg + MO1-egfl7 standard conditions Fig. 6 with imageFig. 7 with image from De Mazière et al., 2008
establishment or maintenance of epithelial cell apical/basal polarity disrupted, abnormal s843Tg + MO1-egfl7 standard conditions Fig. 5 with imageFig. 6 with image from De Mazière et al., 2008
dorsal aorta blood vessel endothelial cell positional polarity, abnormal s843Tg + MO1-egfl7 standard conditions Fig. 6 with image from De Mazière et al., 2008
dorsal aorta obstructed, abnormal s843Tg + MO1-egfl7 standard conditions Fig. 6 with image from De Mazière et al., 2008
intersegmental vessel morphology, abnormal s843Tg + MO1-egfl7 standard conditions Fig. 2 from Rossi et al., 2015
intersegmental vessel morphology, ameliorated egfl7s981/+; s843Tg + MO1-egfl7 standard conditions Fig. 2 from Rossi et al., 2015
intersegmental vessel morphology, ameliorated egfl7s981/s981; s843Tg + MO1-egfl7 standard conditions Fig. 2 from Rossi et al., 2015
Citations