Morpholino
MO1-churc1
- ID
- ZDB-MRPHLNO-080721-3
- Name
- MO1-churc1
- Previous Names
- None
- Target
- Sequence
-
5' - GCTTCTGGACACAACCGGTACACAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-churc1
| Expressed Gene | Anatomy | Figures |
|---|---|---|
| chrd |
Fig. 2 
from Londin et al., 2007 |
|
| gata2a |
Fig. 3
from Londin et al., 2007 |
|
| hoxb1b |
Fig. 3
from Londin et al., 2007 |
|
| mixl1 |
Fig. 3
from Londin et al., 2007 |
|
| noto |
Fig. 2 ,
Fig. 3
from Londin et al., 2007 |
1 - 5 of 13 Show all
Phenotype
Phenotype resulting from MO1-churc1
1 - 5 of 10 Show all
Phenotype of all Fish created by or utilizing MO1-churc1
1 - 5 of 10 Show all
Citations
- Kok, F.O., Shepherd, I.T., and Sirotkin, H.I. (2010) Churchill and Sip1a repress fibroblast growth factor signaling during zebrafish somitogenesis. Developmental Dynamics : an official publication of the American Association of Anatomists. 239(2):548-558
- Londin, E.R., Mentzer, L., and Sirotkin, H.I. (2007) Churchill regulates cell movement and mesoderm specification by repressing Nodal signaling. BMC Developmental Biology. 7(1):120
1 - 2 of 2
Show