Morpholino
MO6-psen1
- ID
- ZDB-MRPHLNO-080422-3
- Name
- MO6-psen1
- Previous Names
- Target
- Sequence
-
5' - GCCAGAAGATCTACACAAGAGCAGG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO6-psen1
Expressed Gene | Anatomy | Figures |
---|---|---|
baxa |
Fig. 5
from Nery et al., 2017 |
|
ccng1 |
Fig. 2,
text only
from Newman et al., 2009 |
|
ctslb |
Fig. 2,
text only
from Newman et al., 2009 |
|
gnmt |
text only
from Newman et al., 2009 |
|
he1.1 |
text only
from Newman et al., 2009 |
|
hsp70.1 |
text only
from Newman et al., 2009 |
|
neurog1 |
Fig. 5
from Nery et al., 2017 |
|
nt5c3a |
|
text only
from Newman et al., 2009 |
pkp3a |
text only
from Newman et al., 2009 |
|
psap |
|
text only
from Newman et al., 2009 |
psen1 |
Fig. 3
from Nornes et al., 2008 |
|
tp53 |
Fig. 5
from Nery et al., 2017 |
Phenotype
Phenotype resulting from MO6-psen1
Phenotype of all Fish created by or utilizing MO6-psen1
Citations