Morpholino

MO3-lmo4a

ID
ZDB-MRPHLNO-071211-2
Name
MO3-lmo4a
Previous Names
  • MO3-lmo4 (1)
Target
Sequence
5' - ACGTATCTCGAAGGTCAAAGGGTGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-lmo4a
No data available
Phenotype
Phenotype resulting from MO3-lmo4a
No data available
Phenotype of all Fish created by or utilizing MO3-lmo4a
Phenotype Fish Conditions Figures
pectoral fin morphology, abnormal WT + MO2-lmo4a + MO3-lmo4a standard conditions Fig. 1 with image from McCollum et al., 2007
optic vesicle increased size, abnormal WT + MO2-lmo4a + MO3-lmo4a standard conditions Fig. 2 with image from McCollum et al., 2007
hypothalamus increased size, abnormal WT + MO2-lmo4a + MO3-lmo4a standard conditions Fig. 2 with image from McCollum et al., 2007
eye increased size, abnormal WT + MO2-lmo4a + MO3-lmo4a standard conditions Fig. 2 with image from McCollum et al., 2007
diencephalon increased size, abnormal WT + MO2-lmo4a + MO3-lmo4a standard conditions Fig. 2 with image from McCollum et al., 2007
cell population proliferation increased occurrence, abnormal WT + MO2-lmo4a + MO3-lmo4a standard conditions Fig. 6 with image from McCollum et al., 2007
otic vesicle morphology, abnormal WT + MO2-lmo4a + MO3-lmo4a standard conditions Fig. 1 with image from McCollum et al., 2007
optic vesicle has extra parts of type neurectodermal cell, abnormal WT + MO2-lmo4a + MO3-lmo4a standard conditions Fig. 6 with image from McCollum et al., 2007
diencephalon increased length, abnormal WT + MO2-lmo4a + MO3-lmo4a standard conditions Fig. 4 with image from McCollum et al., 2007
head increased size, abnormal WT + MO2-lmo4a + MO3-lmo4a standard conditions Fig. 2 with image from McCollum et al., 2007
cell migration disrupted, abnormal WT + MO2-lmo4a + MO3-lmo4a standard conditions Fig. 6 with image from McCollum et al., 2007
head morphology, abnormal WT + MO2-lmo4a + MO3-lmo4a standard conditions Fig. 1 with image from McCollum et al., 2007
optic stalk increased size, abnormal WT + MO2-lmo4a + MO3-lmo4a standard conditions Fig. 2 with image from McCollum et al., 2007
telencephalon increased length, abnormal WT + MO2-lmo4a + MO3-lmo4a standard conditions Fig. 2 with imageFig. 4 with image from McCollum et al., 2007
retina increased size, abnormal WT + MO2-lmo4a + MO3-lmo4a standard conditions Fig. 1 with image from McCollum et al., 2007
neural plate increased size, abnormal WT + MO2-lmo4a + MO3-lmo4a standard conditions Fig. 5 with image from McCollum et al., 2007
Citations