Morpholino

MO2-tbp

ID

ZDB-MRPHLNO-071129-4

Name

MO2-tbp

Previous Names

None

Target

tbp (1)

Sequence

5' - CAAAAGACGTAAACGATAATTCGCA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-tbp

Expressed Gene	Anatomy	Figures
acp5a	whole organism	Fig. S2 from Ferg et al., 2007
alcamb	whole organism	Fig. S2 from Ferg et al., 2007
amt	whole organism	Fig. S2 from Ferg et al., 2007
anxa1a	whole organism	Fig. S2 from Ferg et al., 2007
anxa1b	(not) whole organism	Fig. S2 from Ferg et al., 2007
apoeb	whole organism	Fig. S2 from Ferg et al., 2007
asb8	whole organism	Fig. S2 from Ferg et al., 2007
btr30	whole organism	Fig. S2 from Ferg et al., 2007
casp3a	whole organism	Fig. S2 from Ferg et al., 2007
cdca4	whole organism	Fig. S2 from Ferg et al., 2007
gca	whole organism	Fig. S2 from Ferg et al., 2007
gngt2a	(not) whole organism	Fig. S2 from Ferg et al., 2007
hnf4a	whole organism	Fig. S2 from Ferg et al., 2007
krt4	whole organism	Fig. S2 from Ferg et al., 2007
ldhd	whole organism	Fig. S2 from Ferg et al., 2007
ldlrap1a	whole organism	Fig. S2 from Ferg et al., 2007
opa1	whole organism	Fig. S2 from Ferg et al., 2007
papss2b	(not) whole organism	Fig. S2 from Ferg et al., 2007
ppp1r14aa	whole organism	Fig. S2 from Ferg et al., 2007
raver1	whole organism	Fig. S2 from Ferg et al., 2007
sh3bp5b	whole organism	Fig. S2 from Ferg et al., 2007
smad2	whole organism	Fig. S2 from Ferg et al., 2007
sp5l	whole organism	Fig. S2 from Ferg et al., 2007
thy1	whole organism	Fig. S2 from Ferg et al., 2007
zfand5a	whole organism	Fig. S2 from Ferg et al., 2007
zgc:55461	whole organism	Fig. S2 from Ferg et al., 2007
znf703	(not) whole organism	Fig. S2 from Ferg et al., 2007

Phenotype

Phenotype resulting from MO2-tbp

Phenotype	Fish	Figures
epiboly involved in gastrulation with mouth forming second arrested, abnormal	AB/TU + MO2-tbp	Fig. 2 from Ferg et al., 2007

Phenotype of all Fish created by or utilizing MO2-tbp

Phenotype	Fish	Conditions	Figures
epiboly involved in gastrulation with mouth forming second arrested, abnormal	AB/TU + MO2-tbp	standard conditions	Fig. 2 from Ferg et al., 2007

Citations