Morpholino
MO1-mapk8b
- ID
- ZDB-MRPHLNO-071126-2
- Name
- MO1-mapk8b
- Previous Names
-
- JNK-MO (1)
- MO1-mapk8
- Target
- Sequence
-
5' - ACTGTATCCTGGGCATTCAAGAAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mapk8b
Expressed Gene | Anatomy | Figures |
---|---|---|
bmp2b |
Fig. 5 ![]() |
|
chrd |
Fig. 5 ![]() |
|
dharma |
Fig. 8 ![]() |
|
eve1 |
Fig. 5 ![]() |
|
gata2a |
Fig. 5 ![]() |
1 - 5 of 8 Show all
Phenotype
Phenotype resulting from MO1-mapk8b
1 - 5 of 5
Phenotype of all Fish created by or utilizing MO1-mapk8b
1 - 5 of 5
Citations
- Gao, Q., Zhang, J., Wang, X., Liu, Y., He, R., Liu, X., Wang, F., Feng, J., Yang, D., Wang, Z., Meng, A., Yan, X. (2017) The signalling receptor MCAM coordinates apical-basal polarity and planar cell polarity during morphogenesis. Nature communications. 8:15279
- Rui, Y., Xu, Z., Xiong, B., Cao, Y., Lin, S., Zhang, M., Chan, S.C., Luo, W., Han, Y., Lu, Z., Ye, Z., Zhou, H.M., Han, J., Meng, A., and Lin, S.C. (2007) A beta-Catenin-Independent Dorsalization Pathway Activated by Axin/JNK Signaling and Antagonized by Aida. Developmental Cell. 13(2):268-282
1 - 2 of 2
Show