Morpholino

MO1-tax1bp3

ID

ZDB-MRPHLNO-070712-1

Name

MO1-tax1bp3

Previous Names

tip-MO (1)

Target

tax1bp3 (1)

Sequence

5' - CGACATTTTCTTCTGCTTAAAAAGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

This morpholino has a 1 base pair mismatch in comparison to previously described tax1bp3, accession NM_213470. This morpholino is designed to be a translation blocker.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-tax1bp3

Expressed Gene	Anatomy	Figures
ctslb	prechordal plate	Fig. 5 from Besser et al., 2007
dlx3b	neural plate	Fig. 5 from Besser et al., 2007
gsc	shield	Fig. 5 from Besser et al., 2007
tbxta	notochord	Fig. 5 from Besser et al., 2007

Phenotype

Phenotype resulting from MO1-tax1bp3

Phenotype	Fish	Figures
convergent extension involved in axis elongation disrupted, abnormal	WT + MO1-tax1bp3	Fig. 4, Fig. 5 from Besser et al., 2007
head increased size, abnormal	WT + MO1-tax1bp3	Fig. 4 from Besser et al., 2007
neural plate malformed, abnormal	WT + MO1-tax1bp3	Fig. 5 from Besser et al., 2007
notochord malformed, abnormal	WT + MO1-tax1bp3	Fig. 5 from Besser et al., 2007
pericardium increased size, abnormal	WT + MO1-tax1bp3	Fig. 4 from Besser et al., 2007
prechordal plate malformed, abnormal	WT + MO1-tax1bp3	Fig. 5 from Besser et al., 2007
whole organism anterior-posterior axis decreased length, abnormal	WT + MO1-tax1bp3	Fig. 4 from Besser et al., 2007

Phenotype of all Fish created by or utilizing MO1-tax1bp3

Phenotype	Fish	Conditions	Figures
notochord malformed, abnormal	WT + MO1-tax1bp3	standard conditions	Fig. 5 from Besser et al., 2007
convergent extension involved in axis elongation disrupted, abnormal	WT + MO1-tax1bp3	standard conditions	Fig. 4, Fig. 5 from Besser et al., 2007
whole organism anterior-posterior axis decreased length, abnormal	WT + MO1-tax1bp3	standard conditions	Fig. 4 from Besser et al., 2007
neural plate malformed, abnormal	WT + MO1-tax1bp3	standard conditions	Fig. 5 from Besser et al., 2007
head increased size, abnormal	WT + MO1-tax1bp3	standard conditions	Fig. 4 from Besser et al., 2007
pericardium increased size, abnormal	WT + MO1-tax1bp3	standard conditions	Fig. 4 from Besser et al., 2007
prechordal plate malformed, abnormal	WT + MO1-tax1bp3	standard conditions	Fig. 5 from Besser et al., 2007

Citations