Morpholino

MO5-jag2b

ID
ZDB-MRPHLNO-070614-1
Name
MO5-jag2b
Previous Names
  • MO5-jag2
Target
Sequence
5' - CATGCCGCCGATTTGATGTGTTATA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
translation blocker (-22 to +3)
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-jag2b
Expressed Gene Anatomy Figures
atp1b1a Fig. 4 with image from Ma et al., 2007
cetn4 Fig. 4 with image from Ma et al., 2007
foxj1a Fig. 3 with image from Zhou et al., 2015
foxj1b Fig. 3 with image from Zhou et al., 2015
gmnc Fig. 3 with image from Zhou et al., 2015
mcidas Fig. 3 with image from Zhou et al., 2015
rfx2 Fig. 4 with image from Ma et al., 2007
Phenotype
Phenotype resulting from MO5-jag2b
Phenotype Fish Figures
pronephric tubule has extra parts of type pronephric tubule multi-ciliated epithelial cell, abnormal WT + MO5-jag2b Fig. 2 with image from Zhou et al., 2015
pronephros multi-ciliated epithelial cell differentiation increased occurrence, abnormal WT + MO5-jag2b Fig. 2 with image from Zhou et al., 2015
whole organism gmnc expression increased amount, abnormal WT + MO5-jag2b Fig. 3 with image from Zhou et al., 2015
whole organism foxj1a expression increased amount, abnormal WT + MO5-jag2b Fig. 3 with image from Zhou et al., 2015
whole organism mcidas expression increased amount, abnormal WT + MO5-jag2b Fig. 3 with image from Zhou et al., 2015
whole organism foxj1b expression increased amount, abnormal WT + MO5-jag2b Fig. 3 with image from Zhou et al., 2015
Phenotype of all Fish created by or utilizing MO5-jag2b
Phenotype Fish Conditions Figures
whole organism mcidas expression increased amount, abnormal WT + MO5-jag2b standard conditions Fig. 3 with image from Zhou et al., 2015
whole organism gmnc expression increased amount, abnormal WT + MO5-jag2b standard conditions Fig. 3 with image from Zhou et al., 2015
whole organism foxj1a expression increased amount, abnormal WT + MO5-jag2b standard conditions Fig. 3 with image from Zhou et al., 2015
pronephros multi-ciliated epithelial cell differentiation increased occurrence, abnormal WT + MO5-jag2b standard conditions Fig. 2 with image from Zhou et al., 2015
pronephric tubule has extra parts of type pronephric tubule multi-ciliated epithelial cell, abnormal WT + MO5-jag2b standard conditions Fig. 2 with image from Zhou et al., 2015
whole organism foxj1b expression increased amount, abnormal WT + MO5-jag2b standard conditions Fig. 3 with image from Zhou et al., 2015
pronephric tubule lacks parts or has fewer parts of type pronephric tubule multi-ciliated epithelial cell, abnormal WT + MO1-gmnc + MO5-jag2b standard conditions Fig. 2 with image from Zhou et al., 2015
pronephros multi-ciliated epithelial cell differentiation decreased occurrence, abnormal WT + MO1-gmnc + MO5-jag2b standard conditions Fig. 2 with image from Zhou et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.