Morpholino

MO1-cyp26c1

ID

ZDB-MRPHLNO-070410-6

Name

MO1-cyp26c1

Previous Names

None

Target

cyp26c1 (1)

Sequence

5' - AAACTCGGTTATCCTCACCTTGCGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Targets exon-3–intron-3 junction.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-cyp26c1

Expressed Gene	Anatomy	Figures
egr2b	hindbrain neural rod	Fig. S1 from Rydeen et al., 2014
en2a	hindbrain neural rod	Fig. S1 from Rydeen et al., 2014
hoxb4a	hindbrain neural rod	Fig. S1 from Rydeen et al., 2014
ins	posterior pancreatic bud	Fig. 3 from Kinkel et al., 2009
myh6	heart primordium	Fig. 2 from Rydeen et al., 2014
myh7	anterior lateral plate mesoderm cardiovascular system cardiovascular system heart primordium	Fig. 2 from Rydeen et al., 2014
myl7	heart primordium	Fig. 2 from Rydeen et al., 2014

Phenotype

Phenotype resulting from MO1-cyp26c1

No data available

Phenotype of all Fish created by or utilizing MO1-cyp26c1

Phenotype	Fish	Conditions	Figures
heart edematous, abnormal	cyp26a1^rw716/rw716 + MO1-cyp26c1	standard conditions	Fig. S2 from Rydeen et al., 2014
pancreas mislocalised anteriorly, abnormal	cyp26a1^rw716/rw716 + MO1-cyp26c1	standard conditions	Fig. 3 from Kinkel et al., 2009
pancreas increased length, abnormal	cyp26a1^rw716/rw716 + MO1-cyp26c1	standard conditions	Fig. 3 from Kinkel et al., 2009
pancreas development process quality, abnormal	cyp26a1^rw716/rw716 + MO1-cyp26c1	standard conditions	Fig. 3 from Kinkel et al., 2009
hindbrain edematous, abnormal	cyp26a1^rw716/rw716 + MO1-cyp26c1	standard conditions	Fig. S2 from Rydeen et al., 2014
rhombomere 4 egr2b expression mislocalised, abnormal	WT + MO1-cyp26b1 + MO1-cyp26c1 + MO4-tp53	standard conditions	Fig. 6 from Addison et al., 2018
rhombomere 6 egr2b expression mislocalised, abnormal	WT + MO1-cyp26b1 + MO1-cyp26c1 + MO4-tp53	standard conditions	Fig. 6 from Addison et al., 2018
rhombomere 2 egr2b expression mislocalised, abnormal	WT + MO1-cyp26b1 + MO1-cyp26c1 + MO4-tp53	standard conditions	Fig. 6 from Addison et al., 2018
whole organism mmp9 expression increased amount, abnormal	WT + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1	standard conditions	Fig. 5 from Rydeen et al., 2016
whole organism fgf8a expression decreased amount, abnormal	WT + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1	standard conditions	Fig. 4 from Rydeen et al., 2016
heart fgf8a expression decreased amount, abnormal	WT + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1	standard conditions	Fig. 4 from Rydeen et al., 2016
heart mmp9 expression increased amount, abnormal	WT + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1	standard conditions	Fig. 5 from Rydeen et al., 2016
hindbrain edematous, abnormal	WT + MO1-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1	standard conditions	Fig. S2 from Rydeen et al., 2014
atrium has fewer parts of type cardiac muscle cell, abnormal	WT + MO1-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1	standard conditions	Fig. 2 from Rydeen et al., 2014
heart edematous, abnormal	WT + MO1-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1	standard conditions	Fig. S2 from Rydeen et al., 2014
pancreas mislocalised anteriorly, abnormal	cyp26a1^rw716/rw716 + MO1-cyp26b1 + MO1-cyp26c1	standard conditions	Fig. 3 from Kinkel et al., 2009
vagal lobe distended, abnormal	cyp26a1^rw716/rw716 + MO1-cyp26b1 + MO1-cyp26c1	standard conditions	Fig. 2 from Hernandez et al., 2007
hindbrain wholly posteriorized, abnormal	cyp26a1^rw716/rw716 + MO1-cyp26b1 + MO1-cyp26c1	standard conditions	Fig. 2 , Fig. S4 from Hernandez et al., 2007
pancreas development process quality, abnormal	cyp26a1^rw716/rw716 + MO1-cyp26b1 + MO1-cyp26c1	standard conditions	Fig. 3 from Kinkel et al., 2009
pharyngeal endoderm condensed, abnormal	cyp26a1^rw716/rw716 + MO1-cyp26b1 + MO1-cyp26c1	standard conditions	Fig. 2 from Hernandez et al., 2007
pancreas increased length, abnormal	cyp26a1^rw716/rw716 + MO1-cyp26b1 + MO1-cyp26c1	standard conditions	Fig. 3 from Kinkel et al., 2009
rhombomere 4 increased size, abnormal	cyp26a1^rw716/rw716 + MO1-cyp26b1 + MO1-cyp26c1	standard conditions	Fig. 2 , Fig. S4 from Hernandez et al., 2007
hindbrain wholly posteriorized, abnormal	cyp26a1^rw716/rw716 + MO1-cyp26c1 + MO1-dnd1	standard conditions	Fig. S4 from Hernandez et al., 2007
hindbrain morphology, abnormal	cyp26a1^rw716/rw716 + MO1-cyp26c1 + MO1-dnd1	standard conditions	Fig. 2 from Hernandez et al., 2007
rhombomere 4 increased size, abnormal	cyp26a1^rw716/rw716 + MO1-cyp26c1 + MO1-dnd1	standard conditions	Fig. S4 from Hernandez et al., 2007
rhombomere 4 Citrine expression increased distribution, abnormal	fci3Tg/fci3Tg + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53	standard conditions	Fig. 6 from Addison et al., 2018
rhombomere 4 egr2b expression mislocalised, abnormal	fci3Tg/fci3Tg + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53	standard conditions	Fig. 6 from Addison et al., 2018
rhombomere 4 egr2b expression mislocalised, abnormal	WT + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53	standard conditions	Fig. 6 from Addison et al., 2018
rhombomere 6 egr2b expression mislocalised, abnormal	WT + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53	standard conditions	Fig. 6 from Addison et al., 2018
rhombomere 2 egr2b expression mislocalised, abnormal	WT + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53	standard conditions	Fig. 6 from Addison et al., 2018
ventricular myocardium cardiac muscle cell mislocalised, abnormal	f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1	heat shock	Fig. 4 from Rydeen et al., 2016
cardiac ventricle has fewer parts of type cardiac muscle cell, abnormal	f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1	control	Fig. 5 from Rydeen et al., 2016
cardiac ventricle has number of cardiac muscle cell, ameliorated	f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1	chemical treatment by environment: 3-(N-HYDROXYCARBOXAMIDO)-2-ISOBUTYLPROPANOYL-TRP-METHYLAMIDE	Fig. 5 from Rydeen et al., 2016
whole organism myl7 expression decreased amount, abnormal	f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1	standard conditions	Fig. 1 from Rydeen et al., 2016
cardiac ventricle has fewer parts of type cardiac muscle cell, abnormal	f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1	heat shock	Fig. 4 from Rydeen et al., 2016
cardiac ventricle cardiac ventricle morphogenesis decreased process quality, abnormal	f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1	standard conditions	Fig. 1 , Fig. 5 from Rydeen et al., 2016
cardiac ventricle decreased size, abnormal	f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1	standard conditions	Fig. 1 from Rydeen et al., 2016
cardiac ventricle cardiac ventricle morphogenesis decreased process quality, abnormal	f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1	heat shock	Fig. 4 from Rydeen et al., 2016
cardiac muscle cell external to heart, abnormal	f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1	heat shock	Fig. 4 from Rydeen et al., 2016
cardiac ventricle cardiac ventricle morphogenesis process quality, ameliorated	f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1	chemical treatment by environment: 3-(N-HYDROXYCARBOXAMIDO)-2-ISOBUTYLPROPANOYL-TRP-METHYLAMIDE	Fig. 5 from Rydeen et al., 2016
whole organism myh7 expression decreased amount, abnormal	f2Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1	standard conditions	Fig. 1 from Rydeen et al., 2016
presumptive bulbus arteriosus ripply3 expression increased amount, abnormal	fb7Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO4-tp53 + MO5-cyp26a1	standard conditions	Fig 7 from Song et al., 2019
cell migration involved in heart formation process quality, abnormal	fb7Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1	standard conditions	Fig. 2 from Rydeen et al., 2016
cardiac ventricle cell migration involved in heart formation decreased process quality, abnormal	fb9Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1	control	Fig. 2 from Rydeen et al., 2016
aortic arch has extra parts of type blood vessel endothelial cell, abnormal	fb9Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1	control	Fig. 2 from Rydeen et al., 2016
bulbus arteriosus outflow tract morphogenesis decreased process quality, abnormal	sd22Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1	heat shock	Fig. 4 from Rydeen et al., 2016
bulbus arteriosus outflow tract morphogenesis process quality, ameliorated	sd22Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1	chemical treatment by environment: 3-(N-HYDROXYCARBOXAMIDO)-2-ISOBUTYLPROPANOYL-TRP-METHYLAMIDE	Fig. 5 from Rydeen et al., 2016
cardiac muscle cell external to heart, abnormal	sd22Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1	standard conditions	Fig. 1 from Rydeen et al., 2016
cardiac muscle cell mislocalised, abnormal	sd22Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1	standard conditions	Fig. 1 from Rydeen et al., 2016
bulbus arteriosus outflow tract morphogenesis decreased process quality, abnormal	sd22Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1	standard conditions	Fig. 1 , Fig. 5 from Rydeen et al., 2016
ventricular myocardium cardiac muscle cell mislocalised, abnormal	twu34Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1	control	Fig. 3 from Rydeen et al., 2016
cardiac ventricle cardiac ventricle morphogenesis decreased process quality, abnormal	twu34Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1	control	Fig. 3 from Rydeen et al., 2016
cardiac ventricle cardiac muscle cell circular, abnormal	twu34Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1	control	Fig. 3 from Rydeen et al., 2016
ventricular myocardium cell-cell junction ab1-ctnnb labeling spatial pattern, abnormal	twu34Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1	control	Fig. 3 from Rydeen et al., 2016
ventricular myocardium bicellular tight junction ab1-tjp1 labeling spatial pattern, abnormal	twu34Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1	control	Fig. 3 from Rydeen et al., 2016
cardiac ventricle establishment of cell polarity decreased process quality, abnormal	twu34Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1	control	Fig. 3 from Rydeen et al., 2016
endocardium has fewer parts of type endothelial cell, abnormal	ubs1Tg + MO1-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1	standard conditions	Fig. 7 from Rydeen et al., 2014
cranial vasculature has fewer parts of type endothelial cell, abnormal	ubs1Tg + MO1-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1	standard conditions	Fig. 7 from Rydeen et al., 2014
ventricular myocardium increased distance ventricular endocardium, abnormal	ci5Tg; twu34Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1	control	Fig. 3 from Rydeen et al., 2016
cardiac ventricle cardiac ventricle morphogenesis decreased process quality, abnormal	ci5Tg; twu34Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1	control	Fig. 3 from Rydeen et al., 2016
aortic arch 4 has extra parts of type blood vessel endothelial cell, abnormal	fb9Tg; ubs1Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1	control	Fig. 2 from Rydeen et al., 2016
cardiac ventricle cell migration involved in heart formation decreased process quality, abnormal	fb9Tg; ubs1Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1	control	Fig. 2 from Rydeen et al., 2016
aortic arch 3 has extra parts of type blood vessel endothelial cell, abnormal	fb9Tg; ubs1Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1	control	Fig. 2 from Rydeen et al., 2016
ventricular myocardium cardiac muscle cell mislocalised, abnormal	f2Tg; pd3Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1	heat shock	Fig. 4 from Rydeen et al., 2016
cardiac ventricle has fewer parts of type cardiac muscle cell, abnormal	f2Tg; pd3Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1	heat shock	Fig. 4 from Rydeen et al., 2016
cardiac ventricle has number of cardiac muscle cell, ameliorated	f2Tg; pd3Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1	heat shock	Fig. 4 from Rydeen et al., 2016
cardiac muscle cell external to heart, abnormal	f2Tg; pd3Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1	heat shock	Fig. 4 from Rydeen et al., 2016
cardiac ventricle cardiac ventricle morphogenesis decreased process quality, abnormal	f2Tg; pd3Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1	heat shock	Fig. 4 from Rydeen et al., 2016
bulbus arteriosus outflow tract morphogenesis process quality, ameliorated	pd3Tg; sd22Tg + MO1-cyp26c1 + MO2-cyp26c1 + MO4-cyp26a1 + MO5-cyp26a1	heat shock	Fig. 4 from Rydeen et al., 2016

Citations