Morpholino

MO1-cyp26b1

ID

ZDB-MRPHLNO-070410-1

Name

MO1-cyp26b1

Previous Names

None

Target

cyp26b1 (1)

Sequence

5' - CTCGAAGAGCATGGCTGTGAACGTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Targets start ATG.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-cyp26b1

Expressed Gene	Anatomy	Figures
ins	posterior pancreatic bud	Fig. 3 from Kinkel et al., 2009

Phenotype

Phenotype resulting from MO1-cyp26b1

No data available

Phenotype of all Fish created by or utilizing MO1-cyp26b1

Phenotype	Fish	Conditions	Figures
pancreas development process quality, abnormal	cyp26a1^rw716/rw716 + MO1-cyp26b1	standard conditions	Fig. 3 from Kinkel et al., 2009
pancreas mislocalised anteriorly, abnormal	cyp26a1^rw716/rw716 + MO1-cyp26b1	standard conditions	Fig. 3 from Kinkel et al., 2009
pancreas increased length, abnormal	cyp26a1^rw716/rw716 + MO1-cyp26b1	standard conditions	Fig. 3 from Kinkel et al., 2009
rhombomere 2 egr2b expression mislocalised, abnormal	WT + MO1-cyp26b1 + MO1-cyp26c1 + MO4-tp53	standard conditions	Fig. 6 from Addison et al., 2018
rhombomere 6 egr2b expression mislocalised, abnormal	WT + MO1-cyp26b1 + MO1-cyp26c1 + MO4-tp53	standard conditions	Fig. 6 from Addison et al., 2018
rhombomere 4 egr2b expression mislocalised, abnormal	WT + MO1-cyp26b1 + MO1-cyp26c1 + MO4-tp53	standard conditions	Fig. 6 from Addison et al., 2018
pancreas mislocalised anteriorly, abnormal	cyp26a1^rw716/rw716 + MO1-cyp26b1 + MO1-cyp26c1	standard conditions	Fig. 3 from Kinkel et al., 2009
rhombomere 4 increased size, abnormal	cyp26a1^rw716/rw716 + MO1-cyp26b1 + MO1-cyp26c1	standard conditions	Fig. 2 , Fig. S4 from Hernandez et al., 2007
hindbrain wholly posteriorized, abnormal	cyp26a1^rw716/rw716 + MO1-cyp26b1 + MO1-cyp26c1	standard conditions	Fig. 2 , Fig. S4 from Hernandez et al., 2007
vagal lobe distended, abnormal	cyp26a1^rw716/rw716 + MO1-cyp26b1 + MO1-cyp26c1	standard conditions	Fig. 2 from Hernandez et al., 2007
pancreas increased length, abnormal	cyp26a1^rw716/rw716 + MO1-cyp26b1 + MO1-cyp26c1	standard conditions	Fig. 3 from Kinkel et al., 2009
pancreas development process quality, abnormal	cyp26a1^rw716/rw716 + MO1-cyp26b1 + MO1-cyp26c1	standard conditions	Fig. 3 from Kinkel et al., 2009
pharyngeal endoderm condensed, abnormal	cyp26a1^rw716/rw716 + MO1-cyp26b1 + MO1-cyp26c1	standard conditions	Fig. 2 from Hernandez et al., 2007
rhombomere 4 increased size, abnormal	cyp26a1^rw716/rw716 + MO1-cyp26b1 + MO1-dnd1	standard conditions	Fig. 2 , Fig. S4 from Hernandez et al., 2007
rhombomere 4 Citrine expression increased distribution, abnormal	fci3Tg/fci3Tg + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53	standard conditions	Fig. 6 from Addison et al., 2018
rhombomere 4 egr2b expression mislocalised, abnormal	fci3Tg/fci3Tg + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53	standard conditions	Fig. 6 from Addison et al., 2018
rhombomere 4 egr2b expression mislocalised, abnormal	WT + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53	standard conditions	Fig. 6 from Addison et al., 2018
rhombomere 6 egr2b expression mislocalised, abnormal	WT + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53	standard conditions	Fig. 6 from Addison et al., 2018
rhombomere 2 egr2b expression mislocalised, abnormal	WT + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53	standard conditions	Fig. 6 from Addison et al., 2018

Citations