Morpholino

MO1-cyp26b1

ID
ZDB-MRPHLNO-070410-1
Name
MO1-cyp26b1
Previous Names
None
Target
Sequence
5' - CTCGAAGAGCATGGCTGTGAACGTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Targets start ATG.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cyp26b1
Expressed Gene Anatomy Figures
ins Fig. 3 with image from Kinkel et al., 2009
Phenotype
Phenotype resulting from MO1-cyp26b1
No data available
Phenotype of all Fish created by or utilizing MO1-cyp26b1
Phenotype Fish Conditions Figures
pancreas development process quality, abnormal cyp26a1rw716/rw716 + MO1-cyp26b1 standard conditions Fig. 3 with image from Kinkel et al., 2009
pancreas mislocalised anteriorly, abnormal cyp26a1rw716/rw716 + MO1-cyp26b1 standard conditions Fig. 3 with image from Kinkel et al., 2009
pancreas increased length, abnormal cyp26a1rw716/rw716 + MO1-cyp26b1 standard conditions Fig. 3 with image from Kinkel et al., 2009
rhombomere 2 egr2b expression mislocalised, abnormal WT + MO1-cyp26b1 + MO1-cyp26c1 + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 6 egr2b expression mislocalised, abnormal WT + MO1-cyp26b1 + MO1-cyp26c1 + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 4 egr2b expression mislocalised, abnormal WT + MO1-cyp26b1 + MO1-cyp26c1 + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
pancreas mislocalised anteriorly, abnormal cyp26a1rw716/rw716 + MO1-cyp26b1 + MO1-cyp26c1 standard conditions Fig. 3 with image from Kinkel et al., 2009
rhombomere 4 increased size, abnormal cyp26a1rw716/rw716 + MO1-cyp26b1 + MO1-cyp26c1 standard conditions Fig. 2 with imageFig. S4 with image from Hernandez et al., 2007
hindbrain wholly posteriorized, abnormal cyp26a1rw716/rw716 + MO1-cyp26b1 + MO1-cyp26c1 standard conditions Fig. 2 with imageFig. S4 with image from Hernandez et al., 2007
vagal lobe distended, abnormal cyp26a1rw716/rw716 + MO1-cyp26b1 + MO1-cyp26c1 standard conditions Fig. 2 with image from Hernandez et al., 2007
pancreas increased length, abnormal cyp26a1rw716/rw716 + MO1-cyp26b1 + MO1-cyp26c1 standard conditions Fig. 3 with image from Kinkel et al., 2009
pancreas development process quality, abnormal cyp26a1rw716/rw716 + MO1-cyp26b1 + MO1-cyp26c1 standard conditions Fig. 3 with image from Kinkel et al., 2009
pharyngeal endoderm condensed, abnormal cyp26a1rw716/rw716 + MO1-cyp26b1 + MO1-cyp26c1 standard conditions Fig. 2 with image from Hernandez et al., 2007
rhombomere 4 increased size, abnormal cyp26a1rw716/rw716 + MO1-cyp26b1 + MO1-dnd1 standard conditions Fig. 2 with imageFig. S4 with image from Hernandez et al., 2007
rhombomere 4 Citrine expression increased distribution, abnormal fci3Tg/fci3Tg + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 4 egr2b expression mislocalised, abnormal fci3Tg/fci3Tg + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 6 egr2b expression mislocalised, abnormal WT + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 4 egr2b expression mislocalised, abnormal WT + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 2 egr2b expression mislocalised, abnormal WT + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
Citations