Morpholino

MO1-selenon

ID

ZDB-MRPHLNO-070301-5

Name

MO1-selenon

Previous Names

Target

Sequence

5' - TATCCACGTCTGCGGCCATACTTTA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-selenon

Expressed Gene	Anatomy	Figures
fgf8a	diencephalon midbrain hindbrain boundary tail bud telencephalon	text only from Deniziak et al., 2007
myhz2	fast muscle cell	Fig. s2 from Deniziak et al., 2007
myog	skeletal muscle cell somite	text only from Deniziak et al., 2007
neurog1	neuron	text only from Deniziak et al., 2007
pax2a	hindbrain midbrain hindbrain boundary optic stalk pronephric duct spinal cord	text only from Deniziak et al., 2007
sb:cb306	pronephric duct telencephalon	text only from Deniziak et al., 2007
tbx16	paraxial mesoderm tail bud	text only from Deniziak et al., 2007
tbxta	notochord tail bud	text only from Deniziak et al., 2007
tnnc1b	slow muscle cell	Fig. s2 from Deniziak et al., 2007
xirp2a	myoseptum somite border	Fig. 4, Fig. s2 from Deniziak et al., 2007

Phenotype

Phenotype resulting from MO1-selenon

Phenotype	Fish	Figures
heart edematous, abnormal	WT + MO1-selenon	Fig. 2 from Deniziak et al., 2007
muscle cell sarcomere collapsed, abnormal	WT + MO1-selenon	Fig. 7 from Deniziak et al., 2007
muscle cell sarcomere disorganized, abnormal	WT + MO1-selenon	Fig. 7, Fig. 8 from Deniziak et al., 2007
myoseptum perforate, abnormal	WT + MO1-selenon	Fig. 4, Fig. 7 from Deniziak et al., 2007
myotome disorganized, abnormal	WT + MO1-selenon	Fig. 5, Fig. 6 from Deniziak et al., 2007
myotome vacuolated, abnormal	WT + MO1-selenon	Fig. 2 from Deniziak et al., 2007
skeletal muscle fiber development disrupted, abnormal	WT + MO1-selenon	Fig. 5 from Deniziak et al., 2007
somite malformed, abnormal	WT + MO1-selenon	Fig. 2 from Deniziak et al., 2007
swim bladder aplastic, abnormal	WT + MO1-selenon	text only from Deniziak et al., 2007
swim bladder formation growth quality of occurrent, abnormal	WT + MO1-selenon	text only from Deniziak et al., 2007

Phenotype of all Fish created by or utilizing MO1-selenon

Phenotype	Fish	Conditions	Figures
myoseptum perforate, abnormal	WT + MO1-selenon	standard conditions	Fig. 4, Fig. 7 from Deniziak et al., 2007
skeletal muscle fiber development disrupted, abnormal	WT + MO1-selenon	standard conditions	Fig. 5 from Deniziak et al., 2007
swim bladder formation growth quality of occurrent, abnormal	WT + MO1-selenon	standard conditions	text only from Deniziak et al., 2007
myotome vacuolated, abnormal	WT + MO1-selenon	standard conditions	Fig. 2 from Deniziak et al., 2007
muscle cell sarcomere disorganized, abnormal	WT + MO1-selenon	standard conditions	Fig. 7, Fig. 8 from Deniziak et al., 2007
heart edematous, abnormal	WT + MO1-selenon	standard conditions	Fig. 2 from Deniziak et al., 2007
somite malformed, abnormal	WT + MO1-selenon	standard conditions	Fig. 2 from Deniziak et al., 2007
myotome disorganized, abnormal	WT + MO1-selenon	standard conditions	Fig. 5, Fig. 6 from Deniziak et al., 2007
muscle cell sarcomere collapsed, abnormal	WT + MO1-selenon	standard conditions	Fig. 7 from Deniziak et al., 2007
swim bladder aplastic, abnormal	WT + MO1-selenon	standard conditions	text only from Deniziak et al., 2007

Citations