Morpholino
MO2-fezf2
- ID
- ZDB-MRPHLNO-070129-7
- Name
- MO2-fezf2
- Previous Names
-
- fezl-sp3 (1)
- Target
- Sequence
-
5' - TATTTTAACCTACCTGTGTGTGAAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Exon2-Intron2 splice-blocker
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-fezf2
Expressed Gene | Anatomy | Figures |
---|---|---|
emx2 |
Fig. 2 ![]() |
|
eomesa |
Fig. 5
from Chen et al., 2011 |
|
fgf8a |
Fig. 2 ![]() |
|
foxb1a |
Fig. 2 ![]() ![]() |
|
lhx2b |
Fig. 5
from Chen et al., 2011 |
1 - 5 of 12 Show all
Phenotype
Phenotype resulting from MO2-fezf2
1 - 3 of 3
Phenotype of all Fish created by or utilizing MO2-fezf2
1 - 5 of 6 Show all
Citations
- Berberoglu, M.A., Dong, Z., Li, G., Zheng, J., Trejo Martinez, L.d.e.l. .C., Peng, J., Wagle, M., Reichholf, B., Petritsch, C., Li, H., Pleasure, S.J., Guo, S. (2014) Heterogeneously Expressed fezf2 Patterns Gradient Notch Activity in Balancing the Quiescence, Proliferation, and Differentiation of Adult Neural Stem Cells. The Journal of neuroscience : the official journal of the Society for Neuroscience. 34:13911-23
- Wolf, A., and Ryu, S. (2013) Specification of posterior hypothalamic neurons requires coordinated activities of Fezf2, Otp, Sim1a and Foxb1.2. Development (Cambridge, England). 140(8):1762-1773
- Yang, N., Dong, Z., and Guo, S. (2012) Fezf2 Regulates Multilineage Neuronal Differentiation through Activating Basic Helix-Loop-Helix and Homeodomain Genes in the Zebrafish Ventral Forebrain. The Journal of neuroscience : the official journal of the Society for Neuroscience. 32(32):10940-10948
- Chen, L., Zheng, J., Yang, N., Li, H., and Guo, S. (2011) Genomic selection identifies vertebrate transcription factor Fezf2 binding sites and target genes. The Journal of biological chemistry. 286(21):18641-18649
- Blechman, J., Borodovsky, N., Eisenberg, M., Nabel-Rosen, H., Grimm, J., and Levkowitz, G. (2007) Specification of hypothalamic neurons by dual regulation of the homeodomain protein Orthopedia. Development (Cambridge, England). 134(24):4417-4426
- Jeong, J.Y., Einhorn, Z., Mathur, P., Chen, L., Lee, S., Kawakami, K., and Guo, S. (2007) Patterning the zebrafish diencephalon by the conserved zinc-finger protein Fezl. Development (Cambridge, England). 134(1):127-136
- Jeong, J.Y., Einhorn, Z., Mercurio, S., Lee, S., Lau, B., Mione, M., Wilson, S.W., and Guo, S. (2006) Neurogenin1 is a determinant of zebrafish basal forebrain dopaminergic neurons and is regulated by the conserved zinc finger protein Tof/Fezl. Proceedings of the National Academy of Sciences of the United States of America. 103(13):5143-5148
1 - 7 of 7
Show