Morpholino

MO1-foxc1a

ID

ZDB-MRPHLNO-061111-1

Name

MO1-foxc1a

Previous Names

None

Target

foxc1a (1)

Sequence

5' - GTCAAGAAGACTGAAGCAATCCACA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-foxc1a

Expressed Gene	Anatomy	Figures
cdh17	pronephric duct	Fig. 3 from O'Brien et al., 2011
hey1	pronephric podocyte somite	Fig. 3 from O'Brien et al., 2011
nphs1	pronephric podocyte	Fig. 3 from O'Brien et al., 2011
nr5a1a	interrenal primordium	Fig. 3 from O'Brien et al., 2011
pax2a	pronephric glomerulus pronephric tubule	Fig. 3 from O'Brien et al., 2011
podxl	pronephric podocyte	Fig. 3 from O'Brien et al., 2011
slc20a1a	pronephric proximal straight tubule	Fig. 3 from O'Brien et al., 2011
wt1b	pronephric podocyte	Fig. 3 from O'Brien et al., 2011

Phenotype

Phenotype resulting from MO1-foxc1a

Phenotype	Fish	Figures
pronephric podocyte decreased amount, abnormal	TU + MO1-foxc1a	Fig. 3 from O'Brien et al., 2011

Phenotype of all Fish created by or utilizing MO1-foxc1a

Phenotype	Fish	Conditions	Figures
pronephric podocyte decreased amount, abnormal	TU + MO1-foxc1a	standard conditions	Fig. 3 from O'Brien et al., 2011
optic fissure closure incomplete, abnormal	WT + MO1-foxc1a + MO2-foxc1a	standard conditions	Fig. 6 from Lupo et al., 2011
closure of optic fissure arrested, abnormal	WT + MO1-foxc1a + MO2-foxc1a	standard conditions	Fig. 6 from Lupo et al., 2011
endocardium decreased size, abnormal	WT + MO13-tp53 + MO1-foxc1a + MO3-foxc1a	standard conditions	Fig. S5 from Palencia-Desai et al., 2011
endocardium morphology, abnormal	WT + MO13-tp53 + MO1-foxc1a + MO3-foxc1a	standard conditions	Fig. S5 from Palencia-Desai et al., 2011
endocardium morphology, abnormal	s843Tg + MO13-tp53 + MO1-foxc1a + MO3-foxc1a	standard conditions	Fig. S5 from Palencia-Desai et al., 2011
endocardium decreased size, abnormal	s843Tg + MO13-tp53 + MO1-foxc1a + MO3-foxc1a	standard conditions	Fig. S5 from Palencia-Desai et al., 2011
pronephric podocyte decreased amount, abnormal	TU + MO1-foxc1a + MO3-wt1a	standard conditions	Fig. 3 from O'Brien et al., 2011
interrenal primordium absent, abnormal	TU + MO1-foxc1a + MO3-wt1a	standard conditions	Fig. 3 from O'Brien et al., 2011
pronephric tubule absent, abnormal	TU + MO1-foxc1a + MO3-wt1a	standard conditions	Fig. 3 from O'Brien et al., 2011
interrenal primordium increased size, abnormal	TU + MO1-foxc1a + MO4-rbpja,rbpjb	standard conditions	Fig. 3 from O'Brien et al., 2011
pronephric podocyte decreased amount, abnormal	TU + MO1-foxc1a + MO4-rbpja,rbpjb	standard conditions	Fig. 3 from O'Brien et al., 2011
pronephric tubule morphology, abnormal	TU + MO1-foxc1a + MO4-rbpja,rbpjb	standard conditions	Fig. 3 from O'Brien et al., 2011

Citations