Morpholino

MO1-ndr2

ID
ZDB-MRPHLNO-060930-4
Name
MO1-ndr2
Previous Names
  • Cyclops-MO1 (1)
Target
Sequence
5' - GCGACTCCGAGCGTGTGCATGATG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Contains a one base pair mismatch to minimize secondary structure (Karlen and Rebagliati (2001) Genesis 30: 126-128).
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ndr2
Expressed Gene Anatomy Figures
zic1 Fig. S1 with image from England et al., 2006
Phenotype
Phenotype resulting from MO1-ndr2
Phenotype of all Fish created by or utilizing MO1-ndr2
Phenotype Fish Conditions Figures
camera-type eye morphogenesis disrupted, abnormal AB + MO1-ndr2 standard conditions Fig. 4 with image from England et al., 2006
forebrain morphogenesis disrupted, abnormal AB + MO1-ndr2 standard conditions Fig. 3 with image from England et al., 2006
endoderm formation decreased occurrence, abnormal WT + MO1-ndr2 + MO4-ndr1 standard conditions Fig. 3 with image from Pelliccia et al., 2017
notochord decreased thickness, abnormal WT + MO1-ndr2 + MO4-ndr1 standard conditions Fig. 5 with image from Fan et al., 2007
mesoderm formation decreased occurrence, abnormal WT + MO1-ndr2 + MO4-ndr1 standard conditions Fig. 3 with image from Pelliccia et al., 2017
endoderm aplastic, abnormal WT + MO1-ndr2 + MO4-ndr1 standard conditions Fig. 5 with image from Fan et al., 2007
shield decreased amount, abnormal WT + MO1-ndr2 + MO4-ndr1 standard conditions Fig. 5 with image from Fan et al., 2007
caudal fin morphology, abnormal WT + MO1-ndr2 + MO4-ndr1 standard conditions Fig. 3 with image from Pelliccia et al., 2017
shield aplastic, abnormal WT + MO1-ndr2 + MO4-ndr1 standard conditions Fig. 5 with image from Fan et al., 2007
eye fused with eye, abnormal WT + MO1-ndr2 + MO4-ndr1 standard conditions Fig. 5 with image from Fan et al., 2007
extension aplastic, abnormal foxh1pr1/pr1 + MO1-ndr2 + MO4-ndr1 standard conditions Fig. 5 with image from Slagle et al., 2011
eye malformed, abnormal foxh1pr1/pr1 + MO1-ndr2 + MO4-ndr1 standard conditions Fig. 5 with image from Slagle et al., 2011
whole organism anterior-posterior axis curved ventral, abnormal foxh1pr1/pr1 + MO1-ndr2 + MO4-ndr1 standard conditions Fig. 5 with image from Slagle et al., 2011
post-vent region malformed, abnormal foxh1pr1/pr1 + MO1-ndr2 + MO4-ndr1 standard conditions Fig. 5 with image from Slagle et al., 2011
head morphology, abnormal foxh1pr1/pr1 + MO1-ndr2 + MO4-ndr1 standard conditions Fig. 5 with image from Slagle et al., 2011
head hypoplastic, abnormal foxh1pr1/pr1 + MO1-ndr2 + MO4-ndr1 standard conditions Fig. 5 with image from Slagle et al., 2011
dorsal/ventral pattern formation disrupted, abnormal foxh1pr1/pr1 + MO1-ndr2 + MO4-ndr1 standard conditions Fig. 5 with image from Slagle et al., 2011
endoderm formation decreased occurrence, abnormal gdf3pr05/pr05 + MO1-ndr2 + MO4-ndr1 standard conditions Fig. 3 with image from Pelliccia et al., 2017
mesoderm formation decreased occurrence, abnormal gdf3pr05/pr05 + MO1-ndr2 + MO4-ndr1 standard conditions Fig. 3 with image from Pelliccia et al., 2017
caudal fin morphology, exacerbated gdf3pr05/pr05 + MO1-ndr2 + MO4-ndr1 standard conditions Fig. 3 with image from Pelliccia et al., 2017
Citations