Morpholino
MO1-irx1b
- ID
- ZDB-MRPHLNO-060630-2
- Name
- MO1-irx1b
- Previous Names
-
- MO1 (1)
- Target
- Sequence
-
5' - GCGTGGAGAGGACGGCATTACACCC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-irx1b
| Expressed Gene | Anatomy | Figures |
|---|---|---|
| dmbx1a |
Fig. 6 
from Scholpp et al., 2007 |
|
| gsx1 |
Fig. 6
from Scholpp et al., 2007 |
|
| pax6a |
Fig. 6
from Scholpp et al., 2007 |
|
| shha |
Fig. 7
from Chatterjee et al., 2014 Fig. 6
from Scholpp et al., 2007 |
|
| shhb |
Fig. 6
from Scholpp et al., 2007 |
1 - 5 of 5
Phenotype
Phenotype resulting from MO1-irx1b
1 - 2 of 2
Phenotype of all Fish created by or utilizing MO1-irx1b
1 - 5 of 5
Citations
- Chatterjee, M., Guo, Q., Weber, S., Scholpp, S., and Li, J.Y. (2014) Pax6 regulates the formation of the habenular nuclei by controlling the temporospatial expression of Shh in the diencephalon in vertebrates. BMC Biology. 12(1):13
- Mattes, B., Weber, S., Peres, J., Chen, Q., Davidson, G., Houart, C., and Scholpp, S. (2012) Wnt3 and Wnt3a are required for induction of the mid-diencephalic organizer in the caudal forebrain. Neural Development. 7(1):12
- Scholpp, S., Foucher, I., Staudt, N., Peukert, D., Lumsden, A., and Houart, C. (2007) Otx1l, Otx2 and Irx1b establish and position the ZLI in the diencephalon. Development (Cambridge, England). 134(17):3167-3176
- Itoh, M., Kudoh, T., Dedekian, M., Kim, C.-H., and Chitnis, A.J. (2002) A role for iro1 and iro7 in the establishment of an anteroposterior compartment of the ectoderm adjacent to the midbrain-hindbrain boundary. Development (Cambridge, England). 129(10):2317-2327
1 - 4 of 4
Show