Morpholino

MO1-ptenb

ID
ZDB-MRPHLNO-060214-7
Name
MO1-ptenb
Previous Names
None
Target
Sequence
5' - CTTTCGGACGGTCGGTCGTCTTTA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ptenb
Expressed Gene Anatomy Figures
lcp1 Fig. 5 from Fu et al., 2010
Phenotype
Phenotype resulting from MO1-ptenb
Phenotype Fish Figures
actin filament polymerization increased occurrence, abnormal AB/TU + MO1-ptenb Fig. 10 with image from Yeh et al., 2011
blood decreased fluid flow, abnormal WT + MO1-ptenb Fig. 7 with image from Croushore et al., 2005
caudal fin falciform, abnormal WT + MO1-ptenb Fig. 7 with image from Croushore et al., 2005
convergent extension involved in gastrulation disrupted, abnormal ptenbhu1435/hu1435 + MO1-ptenb Fig. 6 with imageFig. 7 with imagetext only from Yeh et al., 2011
dorsal convergence disrupted, abnormal AB/TU + MO1-ptenb Fig. 5 with imageFig. 7 with image from Yeh et al., 2011
epiboly involved in gastrulation with mouth forming second delayed, abnormal AB/TU + MO1-ptenb Fig. 3 with image from Yeh et al., 2011
extension decreased length, abnormal WT + MO1-ptenb Fig. 7 with image from Croushore et al., 2005
gastrulation disrupted, abnormal AB/TU + MO1-ptenb Fig. 4 with image from Yeh et al., 2011
head domed, abnormal WT + MO1-ptenb Fig. 7 with image from Croushore et al., 2005
hypoblast cell projection direction, abnormal AB/TU + MO1-ptenb Fig. 8 with image from Yeh et al., 2011
hypoblast cell projection physical object quality, abnormal AB/TU + MO1-ptenb Fig. 8 with image from Yeh et al., 2011
intersegmental vessel malformed, abnormal WT + MO1-ptenb Fig. 7 with image from Croushore et al., 2005
lipid phosphatase activity disrupted, abnormal WT + MO1-ptenb Fig. 8 with image from Croushore et al., 2005
macrophage decreased amount, abnormal WT + MO1-ptenb Fig. 5 from Fu et al., 2010
myeloid lineage restricted progenitor cell mislocalised, abnormal zdf11Tg + MO1-ptenb Fig. 5 from Fu et al., 2010
notochord undulate, abnormal WT + MO1-ptenb Fig. 7 with image from Croushore et al., 2005
phosphatidylinositol dephosphorylation decreased occurrence, abnormal WT + MO1-ptenb Fig. 8 with image from Croushore et al., 2005
post-vent region curved dorsal, abnormal WT + MO1-ptenb Fig. 7 with image from Croushore et al., 2005
post-vent region decreased length, abnormal AB/TU + MO1-ptenb Fig. 4 with image from Yeh et al., 2011
somite increased width, abnormal ptenbhu1435/hu1435 + MO1-ptenb Fig. 5 with imagetext only from Yeh et al., 2011
whole organism decreased length, abnormal AB/TU + MO1-ptenb Fig. 4 with image from Yeh et al., 2011
Phenotype of all Fish created by or utilizing MO1-ptenb
Phenotype Fish Conditions Figures
somite increased width, abnormal ptenbhu1435/hu1435 + MO1-ptenb standard conditions text only from Yeh et al., 2011
convergent extension involved in gastrulation disrupted, abnormal ptenbhu1435/hu1435 + MO1-ptenb standard conditions text only from Yeh et al., 2011
hypoblast cell projection direction, abnormal AB/TU + MO1-ptenb standard conditions Fig. 8 with image from Yeh et al., 2011
epiboly involved in gastrulation with mouth forming second delayed, abnormal AB/TU + MO1-ptenb standard conditions Fig. 3 with image from Yeh et al., 2011
somite increased width, abnormal AB/TU + MO1-ptenb standard conditions Fig. 5 with image from Yeh et al., 2011
convergent extension involved in gastrulation disrupted, abnormal AB/TU + MO1-ptenb standard conditions Fig. 6 with imageFig. 7 with image from Yeh et al., 2011
hypoblast cell projection physical object quality, abnormal AB/TU + MO1-ptenb standard conditions Fig. 8 with image from Yeh et al., 2011
dorsal convergence disrupted, abnormal AB/TU + MO1-ptenb standard conditions Fig. 5 with imageFig. 7 with image from Yeh et al., 2011
post-vent region decreased length, abnormal AB/TU + MO1-ptenb standard conditions Fig. 4 with image from Yeh et al., 2011
whole organism decreased length, abnormal AB/TU + MO1-ptenb standard conditions Fig. 4 with image from Yeh et al., 2011
gastrulation disrupted, abnormal AB/TU + MO1-ptenb standard conditions Fig. 4 with image from Yeh et al., 2011
actin filament polymerization increased occurrence, abnormal AB/TU + MO1-ptenb standard conditions Fig. 10 with image from Yeh et al., 2011
blood decreased fluid flow, abnormal WT + MO1-ptenb standard conditions Fig. 7 with image from Croushore et al., 2005
notochord undulate, abnormal WT + MO1-ptenb standard conditions Fig. 7 with image from Croushore et al., 2005
extension decreased length, abnormal WT + MO1-ptenb standard conditions Fig. 7 with image from Croushore et al., 2005
post-vent region curved dorsal, abnormal WT + MO1-ptenb standard conditions Fig. 7 with image from Croushore et al., 2005
phosphatidylinositol dephosphorylation decreased occurrence, abnormal WT + MO1-ptenb standard conditions Fig. 8 with image from Croushore et al., 2005
intersegmental vessel malformed, abnormal WT + MO1-ptenb standard conditions Fig. 7 with image from Croushore et al., 2005
macrophage decreased amount, abnormal WT + MO1-ptenb standard conditions Fig. 5 from Fu et al., 2010
head domed, abnormal WT + MO1-ptenb standard conditions Fig. 7 with image from Croushore et al., 2005
caudal fin falciform, abnormal WT + MO1-ptenb standard conditions Fig. 7 with image from Croushore et al., 2005
lipid phosphatase activity disrupted, abnormal WT + MO1-ptenb standard conditions Fig. 8 with image from Croushore et al., 2005
myeloid lineage restricted progenitor cell mislocalised, abnormal zdf11Tg + MO1-ptenb standard conditions Fig. 5 from Fu et al., 2010
Citations