Morpholino

MO1-ptgs2a

ID
ZDB-MRPHLNO-050722-5
Name
MO1-ptgs2a
Previous Names
  • MO1-ptgs2
  • zCOX-2-A (1)
Target
Sequence
5' - AACCAGTTTATTCATTCCAGAAGTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
designed against translation start
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ptgs2a
Expressed Gene Anatomy Figures
cimap1b Fig. 1 with image,  Fig. 3 from Marra et al., 2019
jag2b Fig. 2 from Marra et al., 2019
mmp9 Fig. 2 from Eisinger et al., 2007
pax2a Fig. 2 from Marra et al., 2019
trpm7 Fig. 3 from Marra et al., 2019
Phenotype
Phenotype resulting from MO1-ptgs2a
Phenotype Fish Figures
brain hydrocephalic, abnormal TU + MO1-ptgs2a Fig. S3 from Marra et al., 2019
pericardium edematous, abnormal TU + MO1-ptgs2a Fig. S3 from Marra et al., 2019
pronephric duct cimap1b expression decreased distribution, abnormal TU + MO1-ptgs2a Fig. 1 with image from Marra et al., 2019
pronephric duct jag2b expression decreased distribution, abnormal TU + MO1-ptgs2a Fig. 2 from Marra et al., 2019
pronephric duct pax2a expression decreased distribution, abnormal TU + MO1-ptgs2a Fig. 2 from Marra et al., 2019
pronephric duct multi-ciliated epithelial cell decreased amount, abnormal TU + MO1-ptgs2a Fig. 1 with image,  Fig. 2 from Marra et al., 2019
pronephric duct multi-ciliated epithelial cell has fewer parts of type multi-ciliated epithelial cell cilium, abnormal TU + MO1-ptgs2a Fig. 4 from Marra et al., 2019
pronephric proximal convoluted tubule multi-ciliated epithelial cell decreased amount, abnormal TU + MO1-ptgs2a Fig. 3 from Marra et al., 2019
pronephric proximal straight tubule multi-ciliated epithelial cell cimap1b expression decreased distribution, abnormal TU + MO1-ptgs2a Fig. 3 from Marra et al., 2019
Phenotype of all Fish created by or utilizing MO1-ptgs2a
Phenotype Fish Conditions Figures
pronephric duct jag2b expression decreased distribution, abnormal TU + MO1-ptgs2a control Fig. 2 from Marra et al., 2019
pronephric duct pax2a expression decreased distribution, abnormal TU + MO1-ptgs2a control Fig. 2 from Marra et al., 2019
pronephric duct multi-ciliated epithelial cell has fewer parts of type multi-ciliated epithelial cell cilium, abnormal TU + MO1-ptgs2a control Fig. 4 from Marra et al., 2019
pronephric duct cimap1b expression decreased distribution, abnormal TU + MO1-ptgs2a chemical treatment by environment: prostaglandin E2 Fig. 1 with image from Marra et al., 2019
brain hydrocephalic, abnormal TU + MO1-ptgs2a control Fig. S3 from Marra et al., 2019
pronephric duct cimap1b expression decreased distribution, abnormal TU + MO1-ptgs2a control Fig. 1 with image from Marra et al., 2019
pronephric proximal convoluted tubule multi-ciliated epithelial cell decreased amount, abnormal TU + MO1-ptgs2a control Fig. 3 from Marra et al., 2019
pronephric proximal straight tubule multi-ciliated epithelial cell cimap1b expression decreased distribution, abnormal TU + MO1-ptgs2a control Fig. 3 from Marra et al., 2019
pericardium edematous, abnormal TU + MO1-ptgs2a control Fig. S3 from Marra et al., 2019
pronephric duct multi-ciliated epithelial cell decreased amount, abnormal TU + MO1-ptgs2a control Fig. 1 with image,  Fig. 2 from Marra et al., 2019
pronephric duct multi-ciliated epithelial cell decreased amount, ameliorated TU + MO1-ptgs2a chemical treatment by environment: prostaglandin E2 Fig. 1 with image from Marra et al., 2019
exocrine pancreas prss1 expression amount, ameliorated WT + MO1-ptgs2a + MO2-ptgs2a chemical treatment: prostaglandin E2 Fig. 2 with image from Nissim et al., 2014
hematopoietic stem cell decreased amount, abnormal WT + MO1-ptgs2a + MO2-ptgs2a standard conditions Fig. S1 from North et al., 2007
exocrine pancreas prss1 expression decreased distribution, abnormal WT + MO1-ptgs2a + MO2-ptgs2a control Fig. 2 with image from Nissim et al., 2014
exocrine pancreas size, ameliorated WT + MO1-ptgs2a + MO2-ptgs2a chemical treatment: prostaglandin E2 Fig. 2 with image from Nissim et al., 2014
exocrine pancreas decreased size, abnormal WT + MO1-ptgs2a + MO2-ptgs2a control Fig. 2 with image from Nissim et al., 2014
liver decreased size, abnormal as3Tg + MO1-ptgs2a + MO2-ptgs2a control Fig. 1 with image from Nissim et al., 2014
liver EGFP expression decreased distribution, abnormal as3Tg + MO1-ptgs2a + MO2-ptgs2a control Fig. 1 with image from Nissim et al., 2014
liver size, ameliorated as3Tg + MO1-ptgs2a + MO2-ptgs2a chemical treatment: prostaglandin E2 Fig. 1 with image from Nissim et al., 2014
liver EGFP expression amount, ameliorated as3Tg + MO1-ptgs2a + MO2-ptgs2a chemical treatment: prostaglandin E2 Fig. 1 with image from Nissim et al., 2014
exocrine pancreas decreased size, abnormal zf578Tg + MO1-ptgs2a + MO2-ptgs2a control Fig. 2 with image from Nissim et al., 2014
exocrine pancreas size, ameliorated zf578Tg + MO1-ptgs2a + MO2-ptgs2a chemical treatment: prostaglandin E2 Fig. 2 with image from Nissim et al., 2014
pronephric duct jag2b expression decreased distribution, abnormal TU + MO1-ptgs1 + MO1-ptgs2a control Fig. 2 from Marra et al., 2019
pronephric duct pax2a expression decreased distribution, abnormal TU + MO1-ptgs1 + MO1-ptgs2a control Fig. 2 from Marra et al., 2019
pronephric duct multi-ciliated epithelial cell has fewer parts of type multi-ciliated epithelial cell cilium, abnormal TU + MO1-ptgs1 + MO1-ptgs2a control Fig. 4 from Marra et al., 2019
pronephric duct cimap1b expression decreased distribution, abnormal TU + MO1-ptgs1 + MO1-ptgs2a chemical treatment by environment: prostaglandin E2 Fig. 1 with image from Marra et al., 2019
brain hydrocephalic, abnormal TU + MO1-ptgs1 + MO1-ptgs2a control Fig. S3 from Marra et al., 2019
pericardium edematous, abnormal TU + MO1-ptgs1 + MO1-ptgs2a control Fig. S3 from Marra et al., 2019
pronephric duct multi-ciliated epithelial cell decreased amount, exacerbated TU + MO1-ptgs1 + MO1-ptgs2a control Fig. 2 from Marra et al., 2019
pronephric duct cimap1b expression decreased distribution, abnormal TU + MO1-ptgs1 + MO1-ptgs2a control Fig. 1 with image from Marra et al., 2019
pronephric proximal convoluted tubule multi-ciliated epithelial cell decreased amount, abnormal TU + MO1-ptgs1 + MO1-ptgs2a control Fig. 3 from Marra et al., 2019
pronephric proximal straight tubule multi-ciliated epithelial cell cimap1b expression decreased distribution, abnormal TU + MO1-ptgs1 + MO1-ptgs2a control Fig. 3 from Marra et al., 2019
pronephric duct multi-ciliated epithelial cell decreased amount, abnormal TU + MO1-ptgs1 + MO1-ptgs2a control Fig. 1 with image from Marra et al., 2019
pronephric duct multi-ciliated epithelial cell decreased amount, ameliorated TU + MO1-ptgs1 + MO1-ptgs2a chemical treatment by environment: prostaglandin E2 Fig. 1 with image from Marra et al., 2019
exocrine pancreas size, ameliorated zf578Tg + MO1-ptger2a + MO1-ptgs2a chemical treatment: prostaglandin E2 Fig. 2 with image from Nissim et al., 2014
exocrine pancreas decreased size, abnormal zf578Tg + MO1-ptger2a + MO1-ptgs2a control Fig. 2 with image from Nissim et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.