Morpholino

MO2-wnt11f2

ID
ZDB-MRPHLNO-050318-3
Name
MO2-wnt11f2
Previous Names
  • MO2-wnt11
  • wnt11-MO (1)
Target
Sequence
5' - GTTCCTGTATTCTGTCATGTCGCTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This is a translation blocking morpholino targeting the translation start site of wnt11.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-wnt11f2
Expressed Gene Anatomy Figures
lpp Fig. 5 with image from Vervenne et al., 2008
Phenotype
Phenotype resulting from MO2-wnt11f2
Phenotype Fish Figures
axis decreased length, abnormal TU + MO2-wnt11f2 Fig. 7 from Yao et al., 2008
convergent extension disrupted, abnormal AB + MO2-wnt11f2 Fig. Table 2 from Matsui et al., 2005
convergent extension process quality, abnormal WT + MO2-wnt11f2 Fig. 3 from Bai et al., 2014
convergent extension involved in axis elongation disrupted, abnormal TU + MO2-wnt11f2 Fig. 7 from Yao et al., 2008
convergent extension involved in gastrulation disrupted, abnormal TU + MO2-wnt11f2 Fig. 7 from Yao et al., 2008
eye decreased amount, abnormal WT + MO2-wnt11f2 Fig. 7 with image from Pei et al., 2009
eye fused with eye, abnormal WT + MO2-wnt11f2 Fig. 4 with image from Musso et al., 2014
eye malformed, abnormal WT + MO2-wnt11f2 Fig. 7 with image from Pei et al., 2009
eye mislocalised, abnormal WT + MO2-wnt11f2 Fig. 7 with image from Pei et al., 2009
gastrulation disrupted, abnormal TU + MO2-wnt11f2 Fig. 7 from Yao et al., 2008
notochord increased width, abnormal TU + MO2-wnt11f2 Fig. 7 from Yao et al., 2008
post-anal tail morphogenesis disrupted, abnormal TU + MO2-wnt11f2 Fig. 7 from Yao et al., 2008
post-vent region decreased length, abnormal TU + MO2-wnt11f2 Fig. 7 from Yao et al., 2008
Phenotype of all Fish created by or utilizing MO2-wnt11f2
Phenotype Fish Conditions Figures
convergent extension disrupted, abnormal AB + MO2-wnt11f2 standard conditions Fig. Table 2 from Matsui et al., 2005
convergent extension involved in axis elongation disrupted, abnormal TU + MO2-wnt11f2 standard conditions Fig. 7 from Yao et al., 2008
convergent extension involved in gastrulation disrupted, abnormal TU + MO2-wnt11f2 standard conditions Fig. 7 from Yao et al., 2008
notochord increased width, abnormal TU + MO2-wnt11f2 standard conditions Fig. 7 from Yao et al., 2008
post-anal tail morphogenesis disrupted, abnormal TU + MO2-wnt11f2 standard conditions Fig. 7 from Yao et al., 2008
gastrulation disrupted, abnormal TU + MO2-wnt11f2 standard conditions Fig. 7 from Yao et al., 2008
axis decreased length, abnormal TU + MO2-wnt11f2 standard conditions Fig. 7 from Yao et al., 2008
post-vent region decreased length, abnormal TU + MO2-wnt11f2 standard conditions Fig. 7 from Yao et al., 2008
eye fused with eye, abnormal WT + MO2-wnt11f2 standard conditions Fig. 4 with image from Musso et al., 2014
eye mislocalised, abnormal WT + MO2-wnt11f2 standard conditions Fig. 7 with image from Pei et al., 2009
convergent extension process quality, abnormal WT + MO2-wnt11f2 standard conditions Fig. 3 from Bai et al., 2014
eye malformed, abnormal WT + MO2-wnt11f2 standard conditions Fig. 7 with image from Pei et al., 2009
eye decreased amount, abnormal WT + MO2-wnt11f2 standard conditions Fig. 7 with image from Pei et al., 2009
eye decreased amount, abnormal ndr1hi975Tg/hi975Tg + MO2-wnt11f2 standard conditions Fig. 7 with image from Pei et al., 2009
eye mislocalised, abnormal ndr1hi975Tg/hi975Tg + MO2-wnt11f2 standard conditions Fig. 7 with image from Pei et al., 2009
eye malformed, abnormal ndr1hi975Tg/hi975Tg + MO2-wnt11f2 standard conditions Fig. 7 with image from Pei et al., 2009
convergent extension disrupted, abnormal AB + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. Table 2 from Matsui et al., 2005
heart tube bifurcated, abnormal AB + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. Table 2 from Matsui et al., 2005
embryonic heart tube morphogenesis disrupted, abnormal AB + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. Table 2 from Matsui et al., 2005
convergent extension involved in gastrulation disrupted, abnormal AB + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 3 from Matsui et al., 2005
embryonic heart tube morphogenesis disrupted, abnormal AB + MO1-wnt11 + MO2-wnt11f2 standard conditions Fig. Table 2 from Matsui et al., 2005
heart tube bifurcated, abnormal AB + MO1-wnt11 + MO2-wnt11f2 standard conditions Fig. Table 2 from Matsui et al., 2005
convergent extension involved in gastrulation disrupted, abnormal AB + MO1-wnt11 + MO2-wnt11f2 standard conditions Fig. 3 from Matsui et al., 2005
convergent extension disrupted, abnormal AB + MO1-wnt11 + MO2-wnt11f2 standard conditions Fig. Table 2 from Matsui et al., 2005
post-anal tail morphogenesis disrupted, abnormal TU + MO1-desi2 + MO2-wnt11f2 standard conditions Fig. 7 from Yao et al., 2008
axis decreased length, abnormal TU + MO1-desi2 + MO2-wnt11f2 standard conditions Fig. 7 from Yao et al., 2008
gastrulation disrupted, abnormal TU + MO1-desi2 + MO2-wnt11f2 standard conditions Fig. 7 from Yao et al., 2008
notochord increased width, abnormal TU + MO1-desi2 + MO2-wnt11f2 standard conditions Fig. 7 from Yao et al., 2008
convergent extension involved in gastrulation disrupted, abnormal TU + MO1-desi2 + MO2-wnt11f2 standard conditions Fig. 7 from Yao et al., 2008
convergent extension involved in axis elongation disrupted, abnormal TU + MO1-desi2 + MO2-wnt11f2 standard conditions Fig. 7 from Yao et al., 2008
post-vent region decreased length, abnormal TU + MO1-desi2 + MO2-wnt11f2 standard conditions Fig. 7 from Yao et al., 2008
eye fused with eye, abnormal WT + MO1-tmem88a + MO2-wnt11f2 standard conditions Fig. 4 with image from Musso et al., 2014
eye fused with eye, abnormal WT + MO2-tmem88a + MO2-wnt11f2 standard conditions Fig. 4 with image from Musso et al., 2014
cardiac muscle tissue morphogenesis process quality, abnormal WT + MO2-wnt11f2 + MO2-wnt5b control Fig. 2 from Merks et al., 2018
convergent extension disrupted, abnormal AB + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. Table 2 from Matsui et al., 2005
embryonic heart tube morphogenesis disrupted, abnormal AB + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. Table 2 from Matsui et al., 2005
intestinal bulb duplicated, abnormal AB + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 5 from Matsui et al., 2005
convergent extension involved in organogenesis disrupted, abnormal AB + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 5 from Matsui et al., 2005
pancreatic bud duplicated, abnormal AB + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 5 from Matsui et al., 2005
heart tube bifurcated, abnormal AB + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. Table 2 from Matsui et al., 2005
convergent extension involved in gastrulation disrupted, abnormal AB + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 3 from Matsui et al., 2005
heart calcium-mediated signaling process quality, abnormal bw6Tg + MO2-wnt11f2 + MO3-wtip standard conditions Fig. 2 from De Jong et al., 2022
whole organism Luciferase expression increased amount, abnormal bw6Tg + MO2-wnt11f2 + MO3-wtip standard conditions Fig. 2 from De Jong et al., 2022
heart decreased functionality, abnormal bw6Tg + MO2-wnt11f2 + MO3-wtip standard conditions Fig. 2 from De Jong et al., 2022
convergent extension disrupted, abnormal twu34Tg + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 3 from Matsui et al., 2005
whole organism apoptotic, abnormal twu34Tg + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 3 from Matsui et al., 2005
convergent extension disrupted, abnormal twu34Tg + MO1-wnt11 + MO2-wnt11f2 standard conditions Fig. 3 from Matsui et al., 2005
convergent extension disrupted, abnormal twu34Tg + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 3 from Matsui et al., 2005
whole organism apoptotic, abnormal twu34Tg + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 3 from Matsui et al., 2005
embryonic heart tube morphogenesis disrupted, abnormal twu34Tg + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 3 from Matsui et al., 2005
heart tube bifurcated, abnormal twu34Tg + MO1-wnt11 + MO1-wnt4 + MO2-wnt11f2 standard conditions Fig. 3 from Matsui et al., 2005
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.