Morpholino

MO1-gli1

ID

ZDB-MRPHLNO-050209-5

Name

MO1-gli1

Previous Names

Target

Sequence

5' - CCGACACACCCGCTACACCCACAGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-gli1

Expressed Gene	Anatomy	Figures
egr2b	rhombomere 3 rhombomere 5	Fig. 6 , Fig. 10 from Vanderlaan et al., 2005
foxa	lateral floor plate medial floor plate	Fig. 5 from Karlstrom et al., 2003
gh1	(not) adenohypophyseal placode	Fig. 4 from Devine et al., 2009
gli1	hindbrain	Fig. 10 from Vanderlaan et al., 2005
neurog1	(not) presumptive intervening zone	Fig. 6 , Fig. 7 from Ninkovic et al., 2008
nkx2.2a	adenohypophyseal placode brain forebrain (not) spinal cord neural tube	Fig. 5 from Devine et al., 2009 Fig. 5 from Karlstrom et al., 2003
ntn1a	rhombomere	Fig. 6 from Vanderlaan et al., 2005
pax2a	presumptive intervening zone	Fig. 6 , Fig. 7 from Ninkovic et al., 2008
pomca	adenohypophyseal placode hypothalamus melanocyte stimulating hormone secreting cell peptide hormone secreting cell	Fig. 4 from Devine et al., 2009
prl	adenohypophyseal placode peptide hormone secreting cell	Fig. 4 , Fig. 5 from Devine et al., 2009
ptch2	hindbrain unspecified	Fig. 5 from Tyurina et al., 2005 Fig. 10 from Vanderlaan et al., 2005
tshba	adenohypophyseal placode thyroid stimulating hormone secreting cell	Fig. 4 from Devine et al., 2009

Phenotype

Phenotype resulting from MO1-gli1

Phenotype	Fish	Figures
adenohypophysis physical object quality, abnormal	WT + MO1-gli1	Fig. 5 from Devine et al., 2009
adenohypophysis morphogenesis process quality, abnormal	WT + MO1-gli1	Fig. 5 from Devine et al., 2009
somatotropin secreting cell decreased amount, abnormal	WT + MO1-gli1	Fig. 4 from Devine et al., 2009
somatotropin secreting cell differentiation process quality, abnormal	WT + MO1-gli1	Fig. 4 from Devine et al., 2009

Phenotype of all Fish created by or utilizing MO1-gli1

Phenotype	Fish	Conditions	Figures
somatotropin secreting cell decreased amount, abnormal	WT + MO1-gli1	standard conditions	Fig. 4 from Devine et al., 2009
adenohypophysis morphogenesis process quality, abnormal	WT + MO1-gli1	standard conditions	Fig. 5 from Devine et al., 2009
adenohypophysis physical object quality, abnormal	WT + MO1-gli1	standard conditions	Fig. 5 from Devine et al., 2009
somatotropin secreting cell differentiation process quality, abnormal	WT + MO1-gli1	standard conditions	Fig. 4 from Devine et al., 2009
cell proliferation in hindbrain occurrence, ameliorated	cdh2^r210/r210 + MO1-gli1 + MO1-gli2a	standard conditions	Fig. 5 from Chalasani et al., 2011
somatotropin secreting cell differentiation process quality, abnormal	WT + MO1-gli1 + MO1-gli2a + MO3-gli2b	standard conditions	Fig. 4 from Devine et al., 2009
somatotropin secreting cell decreased amount, abnormal	WT + MO1-gli1 + MO1-gli2a + MO3-gli2b	standard conditions	Fig. 4 from Devine et al., 2009
myotome EGFP expression decreased distribution, abnormal	kif7^i271/i271; i233Tg + MO1-gli1	standard conditions	Fig. 6 from Maurya et al., 2013
myotome EGFP expression increased distribution, abnormal	kif7^i271/i271; i233Tg + MO1-gli1 + MO1-sufu	standard conditions	Fig. 6 from Maurya et al., 2013

Citations