CRISPR

CRISPR4-dspb

ID

ZDB-CRISPR-240301-12

Name

CRISPR4-dspb

Previous Names

None

Target

dspb (1)

Sequence

5' - GGAAGTGCATCTCCAGACTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
ia303	dspb

Expression

Gene expression in Wild Types + CRISPR4-dspb

No data available

Phenotype

Phenotype resulting from CRISPR4-dspb

No data available

Phenotype of all Fish created by or utilizing CRISPR4-dspb

Phenotype	Fish	Conditions	Figures
heart dilated, abnormal	dspb^ia303/ia303	standard conditions	Fig. 1 from Celeghin et al., 2023
blastema cell population proliferation decreased process quality, abnormal	AB + CRISPR3-dspa + CRISPR3-dspb + CRISPR4-dspa + CRISPR4-dspb + CRISPR5-dspa + CRISPR5-dspb	amputation: ventral fin fold	Fig. S11 from Ha et al., 2022
fin regeneration decreased process quality, abnormal	AB + CRISPR3-dspa + CRISPR3-dspb + CRISPR4-dspa + CRISPR4-dspb + CRISPR5-dspa + CRISPR5-dspb	amputation: ventral fin fold	Fig. S11 from Ha et al., 2022
heart Ab8-lcp1 labeling increased amount, abnormal	dspa^sa13356/+; dspb^ia303/+	standard conditions	Fig. 2 from Celeghin et al., 2023
heart accumulation fat cell, abnormal	dspa^sa13356/+; dspb^ia303/+	standard conditions	Fig. 6 from Celeghin et al., 2023
heart extracellular space increased size, abnormal	dspa^sa13356/+; dspb^ia303/+	standard conditions	Fig. 5 from Celeghin et al., 2023
heart smad2 expression decreased amount, abnormal	dspa^sa13356/+; dspb^ia303/+	standard conditions	Fig. 4 from Celeghin et al., 2023
heart ccn2b expression decreased amount, abnormal	dspa^sa13356/+; dspb^ia303/+	standard conditions	Fig. 4 from Celeghin et al., 2023
heart mycbp expression decreased amount, abnormal	dspa^sa13356/+; dspb^ia303/+	standard conditions	Fig. 4 from Celeghin et al., 2023
myocardium accumulation fat cell, abnormal	dspa^sa13356/+; dspb^ia303/+	standard conditions	Fig. 6 from Celeghin et al., 2023
whole organism decreased length, abnormal	dspa^sa13356/+; dspb^ia303/+	standard conditions	Fig. 1 from Celeghin et al., 2023
whole organism life span, ameliorated	dspa^sa13356/+; dspb^ia303/+	chemical treatment by environment: Wnt signalling activator	Fig. 7 from Celeghin et al., 2023
leukocyte increased amount, abnormal	dspa^sa13356/+; dspb^ia303/+	standard conditions	Fig. 2 from Celeghin et al., 2023
whole organism decreased life span, abnormal	dspa^sa13356/+; dspb^ia303/+	standard conditions	Fig. 7 from Celeghin et al., 2023
heart blood vessel dilated, abnormal	dspa^sa13356/+; dspb^ia303/+	standard conditions	Fig. 6 from Celeghin et al., 2023
heart desmosome disorganized, abnormal	dspa^sa13356/+; dspb^ia303/+	standard conditions	Fig. 5 from Celeghin et al., 2023
heart desmosome low saturation, abnormal	dspa^sa13356/+; dspb^ia303/+	standard conditions	Fig. 5 from Celeghin et al., 2023
eye decreased size, abnormal	dspa^sa13356/+; dspb^ia303/+	standard conditions	Fig. 1 from Celeghin et al., 2023
trabecular layer disorganized, exacerbated	dspa^sa13356/+; dspb^ia303/+	water flow	Fig. 6 from Celeghin et al., 2023
heart blood vessel dilated, exacerbated	dspa^sa13356/+; dspb^ia303/+	water flow	Fig. 6 from Celeghin et al., 2023
cardiac ventricle shape, exacerbated	dspa^sa13356/+; dspb^ia303/+	water flow	Fig. 6 from Celeghin et al., 2023
whole organism decreased life span, exacerbated	dspa^sa13356/+; dspb^ia303/+	chemical treatment by environment: methyl cellulose	Fig. 7 from Celeghin et al., 2023
heart ccnd1 expression decreased amount, abnormal	dspa^sa13356/+; dspb^ia303/+	standard conditions	Fig. 4 from Celeghin et al., 2023
heart accumulation fat cell, exacerbated	dspa^sa13356/+; dspb^ia303/+	water flow	Fig. 6 from Celeghin et al., 2023
heart dilated, abnormal	dspa^sa13356/+; dspb^ia303/+	standard conditions	Fig. 1 from Celeghin et al., 2023
cardiac ventricle dilated, abnormal	dspa^sa13356/+; dspb^ia303/+	standard conditions	Fig. 5 from Celeghin et al., 2023
myocardium accumulation fat cell, exacerbated	dspa^sa13356/+; dspb^ia303/+	water flow	Fig. 6 from Celeghin et al., 2023
whole organism decreased life span, abnormal	dspa^sa13356/+; dspb^ia303/+	chemical treatment by environment: methyl cellulose	Fig. 3 from Celeghin et al., 2023
whole organism decreased life span, ameliorated	dspa^sa13356/+; dspb^ia303/+	chemical treatment by environment: methyl cellulose, chemical treatment by environment: Wnt signalling activator	Fig. 7 from Celeghin et al., 2023
myocardium thickness, abnormal	dspa^sa13356/+; dspb^ia303/+	standard conditions	Fig. 6 from Celeghin et al., 2023
whole organism locomotory behavior decreased duration, abnormal	dspa^sa13356/+; dspb^ia303/+	standard conditions	Fig. 3 from Celeghin et al., 2023
heart ccn2a expression decreased amount, abnormal	dspa^sa13356/+; dspb^ia303/+	standard conditions	Fig. 4 from Celeghin et al., 2023
trabecular layer disorganized, abnormal	dspa^sa13356/+; dspb^ia303/+	standard conditions	Fig. 6 from Celeghin et al., 2023
heart smad3a expression decreased amount, abnormal	dspa^sa13356/+; dspb^ia303/+	standard conditions	Fig. 4 from Celeghin et al., 2023
cardiac ventricle shape, abnormal	dspa^sa13356/+; dspb^ia303/+	standard conditions	Fig. 6 from Celeghin et al., 2023
heart morphology, exacerbated	dspa^sa13356/+; dspb^ia303/+; ia4Tg	chemical treatment by environment: XAV939	Fig. 7 from Celeghin et al., 2023
heart contraction decreased rate, abnormal	dspa^sa13356/+; dspb^ia303/+; ia4Tg	chemical treatment by environment: XAV939	Fig. 7 from Celeghin et al., 2023
heart contraction rate, ameliorated	dspa^sa13356/+; dspb^ia303/+; ia4Tg	chemical treatment by environment: Wnt signalling activator	Fig. 7 from Celeghin et al., 2023
heart contraction decreased rate, abnormal	dspa^sa13356/+; dspb^ia303/+; ia4Tg	standard conditions	Fig. 7 from Celeghin et al., 2023
heart morphology, abnormal	dspa^sa13356/+; dspb^ia303/+; ia4Tg	standard conditions	Fig. 7 from Celeghin et al., 2023
heart morphology, ameliorated	dspa^sa13356/+; dspb^ia303/+; ia4Tg	chemical treatment by environment: Wnt signalling activator	Fig. 7 from Celeghin et al., 2023
heart inflamed, abnormal	dspa^sa13356/+; dspb^ia303/+; ia300Tg	standard conditions	Fig. 2 from Celeghin et al., 2023
heart dilated, abnormal	dspa^sa13356/+; dspb^ia303/+; ia300Tg	standard conditions	Fig. 2 from Celeghin et al., 2023
heart dilated, abnormal	dspa^{sa13356/sa13356}; dspb^ia303/ia303	standard conditions	Fig. 1 from Celeghin et al., 2023

Citations