CRISPR

CRISPR1-rbfox2

ID
ZDB-CRISPR-231201-5
Name
CRISPR1-rbfox2
Previous Names
None
Target
Sequence
5' - GAGATCATCTTCAATGAAAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
chb6 rbfox2
Expression
Gene expression in Wild Types + CRISPR1-rbfox2
No data available
Phenotype
Phenotype resulting from CRISPR1-rbfox2
No data available
Phenotype of all Fish created by or utilizing CRISPR1-rbfox2
Phenotype Fish Conditions Figures
positive regulation of RNA splicing decreased process quality, abnormal rbfox1lchb5/chb5; rbfox2chb6/chb6 standard conditions Fig. 4 with image from Huang et al., 2022
bulbus arteriosus ab3-tnnt labeling spatial pattern, abnormal rbfox1lchb5/chb5; rbfox2chb6/chb6 standard conditions Fig. 6 with image from Huang et al., 2022
dorsal aorta blood vessel endothelium obstructed, abnormal rbfox1lchb5/chb5; rbfox2chb6/chb6 standard conditions Fig. 6 with image from Huang et al., 2022
mitochondrial gene expression decreased rate, abnormal rbfox1lchb5/chb5; rbfox2chb6/chb6 standard conditions Fig. 4 with image from Huang et al., 2022
cardiac muscle cell positive regulation of oxygen metabolic process decreased process quality, abnormal rbfox1lchb5/chb5; rbfox2chb6/chb6 standard conditions Fig. 5 with image from Huang et al., 2022
cardiac muscle cell mitochondrion decreased size, abnormal rbfox1lchb5/chb5; rbfox2chb6/chb6 standard conditions Fig. 5 with image from Huang et al., 2022
bulbus arteriosus ab1-elnb labeling spatial pattern, abnormal rbfox1lchb5/chb5; rbfox2chb6/chb6 standard conditions Fig. 6 with image from Huang et al., 2022
pericardium edematous, abnormal rbfox1lchb5/chb5; rbfox2chb6/chb6 standard conditions Fig. 6 with image from Huang et al., 2022
cardiac muscle cell sarcomere ab-mf20 labeling spatial pattern, abnormal rbfox1lchb5/chb5; rbfox2chb6/chb6 standard conditions Fig. 5 with image from Huang et al., 2022
sarcomere organization decreased process quality, abnormal rbfox1lchb5/chb5; rbfox2chb6/chb6 standard conditions Fig. 4 with image from Huang et al., 2022
cardiac muscle cell Z disc ab3-tnnt labeling spatial pattern, abnormal rbfox1lchb5/chb5; rbfox2chb6/chb6 standard conditions Fig. 5 with image from Huang et al., 2022
heart contraction decreased process quality, abnormal rbfox1lchb5/chb5; rbfox2chb6/chb6 standard conditions Fig. 6 with image from Huang et al., 2022
cardiac muscle cell sarcomere ab-s46 labeling spatial pattern, abnormal rbfox1lchb5/chb5; rbfox2chb6/chb6 standard conditions Fig. 5 with image from Huang et al., 2022
cardiac muscle cell ATP metabolic process decreased process quality, abnormal rbfox1lchb5/chb5; rbfox2chb6/chb6 standard conditions Fig. 5 with image from Huang et al., 2022
cardiac muscle cell sarcomere ab3-tnnt labeling spatial pattern, abnormal rbfox1lchb5/chb5; rbfox2chb6/chb6 standard conditions Fig. 5 with image from Huang et al., 2022
cardiac muscle cell mitochondrion increased amount, abnormal rbfox1lchb5/chb5; rbfox2chb6/chb6 standard conditions Fig. 5 with image from Huang et al., 2022
endocardial cushion zn-8 labeling spatial pattern, abnormal rbfox1lchb5/chb5; rbfox2chb6/chb6 standard conditions Fig. 6 with image from Huang et al., 2022
cardiac muscle cell mitochondrial crista disorganized, abnormal rbfox1lchb5/chb5; rbfox2chb6/chb6 standard conditions Fig. 5 with image from Huang et al., 2022
cardiac muscle cell NAD biosynthetic process decreased process quality, abnormal rbfox1lchb5/chb5; rbfox2chb6/chb6 standard conditions Fig. 5 with image from Huang et al., 2022
cardiac muscle cell Z disc ab-mf20 labeling spatial pattern, abnormal rbfox1lchb5/chb5; rbfox2chb6/chb6 standard conditions Fig. 5 with image from Huang et al., 2022
cardiac muscle cell Z disc ab-s46 labeling spatial pattern, abnormal rbfox1lchb5/chb5; rbfox2chb6/chb6 standard conditions Fig. 5 with image from Huang et al., 2022
cardiac muscle cell EGFP expression spatial pattern, abnormal rbfox1lchb5/chb5; rbfox2chb6/chb6; f1Tg/f1Tg standard conditions Fig. 2 with image from Huang et al., 2022
cardiac muscle cell zn-8 labeling spatial pattern, abnormal rbfox1lchb5/chb5; rbfox2chb6/chb6; f1Tg/f1Tg standard conditions Fig. 2 with image from Huang et al., 2022
bulbus arteriosus ab1-elnb labeling spatial pattern, abnormal rbfox1lchb5/chb5; rbfox2chb6/chb6; f1Tg/f1Tg standard conditions Fig. 2 with image from Huang et al., 2022
cardiac muscle cell EGFP expression decreased amount, abnormal rbfox1lchb5/chb5; rbfox2chb6/chb6; f1Tg/f1Tg standard conditions Fig. 2 with image from Huang et al., 2022
bulbus arteriosus elongated, abnormal rbfox1lchb5/chb5; rbfox2chb6/chb6; f1Tg/f1Tg standard conditions Fig. 2 with image from Huang et al., 2022
whole organism paralysed, abnormal rbfox1lchb5/chb5; rbfox2chb6/chb6; f1Tg/f1Tg standard conditions Fig. 1 with image from Huang et al., 2022
pericardium edematous, abnormal rbfox1lchb5/chb5; rbfox2chb6/chb6; f1Tg/f1Tg standard conditions Fig. 1 with image from Huang et al., 2022
heart contraction decreased process quality, abnormal rbfox1lchb5/chb5; rbfox2chb6/chb6; f1Tg/f1Tg standard conditions Fig. 1 with imageFig. 3 with image from Huang et al., 2022
cardiac ventricle cardiac muscle cell decreased area, abnormal rbfox1lchb5/chb5; rbfox2chb6/chb6; f1Tg/f1Tg standard conditions Fig. 3 with image from Huang et al., 2022
blood circulation decreased process quality, abnormal rbfox1lchb5/chb5; rbfox2chb6/chb6; f1Tg/f1Tg standard conditions Fig. 1 with image from Huang et al., 2022
whole organism dead, abnormal rbfox1lchb5/chb5; rbfox2chb6/chb6; f1Tg/f1Tg standard conditions Fig. 1 with image from Huang et al., 2022
bulbus arteriosus decreased width, abnormal rbfox1lchb5/chb5; rbfox2chb6/chb6; f1Tg/f1Tg standard conditions Fig. 2 with image from Huang et al., 2022
cardiac ventricle cardiac muscle cell zn-8 labeling spatial pattern, abnormal rbfox1lchb5/chb5; rbfox2chb6/chb6; f1Tg/f1Tg standard conditions Fig. 3 with image from Huang et al., 2022
cardiac muscle cell decreased size, abnormal rbfox1lchb5/chb5; rbfox2chb6/chb6; fb18Tg/fb18Tg standard conditions Fig. 3 with image from Huang et al., 2022
cardiac ventricle cell division decreased frequency, abnormal rbfox1lchb5/chb5; rbfox2chb6/chb6; fb18Tg/fb18Tg standard conditions Fig. 2 with image from Huang et al., 2022
endocardial cushion absent, abnormal rbfox1lchb5/chb5; rbfox2chb6/chb6; s896Tg/s896Tg standard conditions Fig. 2 with image from Huang et al., 2022
dorsal aorta blood vessel endothelium obstructed, abnormal rbfox1lchb5/chb5; rbfox2chb6/chb6; s896Tg/s896Tg standard conditions Fig. 2 with image from Huang et al., 2022
dorsal aorta blood vessel endothelium normal object quality, ameliorated rbfox1lchb5/chb5; rbfox2chb6/chb6; chb7Tg/chb7Tg standard conditions Fig. 6 with image from Huang et al., 2022
bulbus arteriosus ab1-elnb labeling spatial pattern, ameliorated rbfox1lchb5/chb5; rbfox2chb6/chb6; chb7Tg/chb7Tg standard conditions Fig. 6 with image from Huang et al., 2022
heart contraction normal process quality, ameliorated rbfox1lchb5/chb5; rbfox2chb6/chb6; chb7Tg/chb7Tg standard conditions Fig. 6 with image from Huang et al., 2022
pericardium normal object quality, ameliorated rbfox1lchb5/chb5; rbfox2chb6/chb6; chb7Tg/chb7Tg standard conditions Fig. 6 with image from Huang et al., 2022
bulbus arteriosus ab3-tnnt labeling spatial pattern, ameliorated rbfox1lchb5/chb5; rbfox2chb6/chb6; chb7Tg/chb7Tg standard conditions Fig. 6 with image from Huang et al., 2022
Citations