CRISPR

CRISPR1-nde1

ID

ZDB-CRISPR-231116-1

Name

CRISPR1-nde1

Previous Names

None

Target

nde1 (1)

Sequence

5' - GATGAGTCGAGACTATGAGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zf3784	nde1

Expression

Gene expression in Wild Types + CRISPR1-nde1

No data available

Phenotype

Phenotype resulting from CRISPR1-nde1

No data available

Phenotype of all Fish created by or utilizing CRISPR1-nde1

Phenotype	Fish	Conditions	Figures
rhombomere apoptotic process increased process quality, abnormal	nde1^{zf3784/zf3784} (TU)	standard conditions	Fig. 2 , Fig. 6 from Zhang et al., 2022
brain il6 expression amount, ameliorated	nde1^{zf3784/zf3784} (TU)	chemical treatment by environment: minocycline	Fig. 7 from Zhang et al., 2022
brain tnfa expression increased amount, abnormal	nde1^{zf3784/zf3784} (TU)	standard conditions	Fig. 5 , Fig. 7 from Zhang et al., 2022
brain il6 expression increased amount, abnormal	nde1^{zf3784/zf3784} (TU)	standard conditions	Fig. 5 , Fig. 7 from Zhang et al., 2022
spinal cord apoptotic process increased process quality, abnormal	nde1^{zf3784/zf3784} (TU)	standard conditions	Fig. 2 , Fig. 6 from Zhang et al., 2022
whole organism bcl2a expression decreased amount, abnormal	nde1^{zf3784/zf3784} (TU)	standard conditions	Fig. 6 from Zhang et al., 2022
telencephalon apoptotic process increased process quality, abnormal	nde1^{zf3784/zf3784} (TU)	standard conditions	Fig. 2 , Fig. 6 from Zhang et al., 2022
swimming behavior increased process quality, abnormal	nde1^{zf3784/zf3784} (TU)	lighting conditions	Fig. 3 from Zhang et al., 2022
whole organism apoeb expression increased amount, abnormal	nde1^{zf3784/zf3784} (TU)	standard conditions	Fig. 6 from Zhang et al., 2022
whole organism pcna expression increased amount, abnormal	nde1^{zf3784/zf3784} (TU)	standard conditions	Fig. 6 from Zhang et al., 2022
whole organism bbc3 expression increased amount, abnormal	nde1^{zf3784/zf3784} (TU)	standard conditions	Fig. 6 from Zhang et al., 2022
brain loose, abnormal	nde1^{zf3784/zf3784} (TU)	standard conditions	Fig. 2 from Zhang et al., 2022
ventricular system increased size, abnormal	nde1^{zf3784/zf3784} (TU)	standard conditions	Fig. 2 from Zhang et al., 2022
brain tnfa expression amount, ameliorated	nde1^{zf3784/zf3784} (TU)	chemical treatment by environment: minocycline	Fig. 7 from Zhang et al., 2022
whole organism pidd1 expression increased amount, abnormal	nde1^{zf3784/zf3784} (TU)	standard conditions	Fig. 6 from Zhang et al., 2022
brain apoeb expression increased amount, abnormal	nde1^{zf3784/zf3784} (TU)	standard conditions	Fig. 5 from Zhang et al., 2022
swimming behavior process quality, ameliorated	nde1^{zf3784/zf3784} (TU)	chemical treatment by environment: minocycline	Fig. 7 from Zhang et al., 2022
brain il1b expression increased amount, abnormal	nde1^{zf3784/zf3784} (TU)	standard conditions	Fig. 5 , Fig. 7 from Zhang et al., 2022
midbrain apoptotic process increased process quality, abnormal	nde1^{zf3784/zf3784} (TU)	standard conditions	Fig. 2 , Fig. 6 from Zhang et al., 2022
whole organism gmnn expression increased amount, abnormal	nde1^{zf3784/zf3784} (TU)	standard conditions	Fig. 6 from Zhang et al., 2022
swimming behavior increased process quality, abnormal	nde1^{zf3784/zf3784} (TU)	lighting conditions	Fig. 3 from Zhang et al., 2022
whole organism bcl2l1 expression decreased amount, abnormal	nde1^{zf3784/zf3784} (TU)	standard conditions	Fig. 6 from Zhang et al., 2022
valvula cerebelli decreased size, abnormal	nde1^{zf3784/zf3784} (TU)	standard conditions	Fig. 2 from Zhang et al., 2022
whole organism bicd2 expression increased amount, abnormal	nde1^{zf3784/zf3784} (TU)	standard conditions	Fig. 6 from Zhang et al., 2022
social behavior decreased process quality, abnormal	nde1^{zf3784/zf3784} (TU)	standard conditions	Fig. 4 , Fig. 7 from Zhang et al., 2022
brain il1b expression amount, ameliorated	nde1^{zf3784/zf3784} (TU)	chemical treatment by environment: minocycline	Fig. 7 from Zhang et al., 2022
swimming behavior increased process quality, abnormal	nde1^{zf3784/zf3784} (TU)	standard conditions	Fig. 3 , Fig. 7 from Zhang et al., 2022
social behavior process quality, ameliorated	nde1^{zf3784/zf3784} (TU)	chemical treatment by environment: minocycline	Fig. 7 from Zhang et al., 2022

Citations