CRISPR

CRISPR6-chd7

ID

ZDB-CRISPR-230504-2

Name

CRISPR6-chd7

Previous Names

None

Target

chd7 (1)

Sequence

5' - AGAATTTCAGATGACGACGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "TGG" at the 3' end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
sr5	chd7

Expression

Gene expression in Wild Types + CRISPR6-chd7

No data available

Phenotype

Phenotype resulting from CRISPR6-chd7

No data available

Phenotype of all Fish created by or utilizing CRISPR6-chd7

Phenotype	Fish	Conditions	Figures
ceratobranchial 4 cartilage decreased length, abnormal	chd7^sr5/sr5	standard conditions	FIGURE 3 from Sun et al., 2022
ceratobranchial 3 cartilage decreased length, abnormal	chd7^sr5/sr5	standard conditions	FIGURE 3 from Sun et al., 2022
ceratobranchial 5 tooth decreased amount, abnormal	chd7^sr5/sr5	standard conditions	FIGURE 3 from Sun et al., 2022
ceratobranchial 3 cartilage decreased length, abnormal	chd7^sr5/sr5	standard conditions	FIGURE 3 from Sun et al., 2022
whole organism chd7 expression decreased amount, abnormal	chd7^sr5/sr5	standard conditions	FIGURE 2 from Sun et al., 2022
pharyngeal arch cartilage lacks parts or has fewer parts of type ceratobranchial 4 cartilage, abnormal	chd7^sr5/sr5	standard conditions	FIGURE 3 from Sun et al., 2022
ceratobranchial 4 cartilage decreased length, abnormal	chd7^sr5/sr5	standard conditions	FIGURE 3 from Sun et al., 2022
basihyal cartilage decreased width, abnormal	chd7^sr5/sr5	standard conditions	FIGURE 3 from Sun et al., 2022
basihyal cartilage decreased width, abnormal	chd7^sr5/sr5	standard conditions	FIGURE 3 from Sun et al., 2022
eye decreased diameter, abnormal	chd7^sr5/sr5	standard conditions	FIGURE 2 from Sun et al., 2022
ceratobranchial cartilage chondrocyte disorganized, abnormal	chd7^sr5/sr5	standard conditions	FIGURE 3 from Sun et al., 2022
ceratobranchial cartilage chondrocyte disorganized, abnormal	chd7^sr5/sr5	standard conditions	FIGURE 3 from Sun et al., 2022
swim bladder decreased size, abnormal	chd7^sr5/sr5	standard conditions	FIGURE 2 from Sun et al., 2022
pharyngeal arch cartilage lacks parts or has fewer parts of type ceratobranchial 4 cartilage, abnormal	chd7^sr5/sr5	standard conditions	FIGURE 3 from Sun et al., 2022
ceratobranchial 4 cartilage shape, abnormal	chd7^sr5/sr5	standard conditions	FIGURE 3 from Sun et al., 2022
ceratobranchial 1 cartilage decreased length, abnormal	chd7^sr5/sr5	standard conditions	FIGURE 3 from Sun et al., 2022
ceratobranchial 4 cartilage shape, abnormal	chd7^sr5/sr5	standard conditions	FIGURE 3 from Sun et al., 2022
ceratobranchial 1 cartilage decreased length, abnormal	chd7^sr5/sr5	standard conditions	FIGURE 3 from Sun et al., 2022
basihyal cartilage morphology, abnormal	chd7^sr5/sr5	standard conditions	FIGURE 3 from Sun et al., 2022
basihyal cartilage morphology, abnormal	chd7^sr5/sr5	standard conditions	FIGURE 3 from Sun et al., 2022
ceratobranchial 5 cartilage decreased length, abnormal	chd7^sr5/sr5	standard conditions	FIGURE 3 from Sun et al., 2022
ceratobranchial 5 cartilage decreased length, abnormal	chd7^sr5/sr5	standard conditions	FIGURE 3 from Sun et al., 2022
pericardium edematous, abnormal	chd7^sr5/sr5	standard conditions	FIGURE 2 from Sun et al., 2022
ceratobranchial 2 cartilage decreased length, abnormal	chd7^sr5/sr5	standard conditions	FIGURE 3 from Sun et al., 2022
ceratobranchial 2 cartilage decreased length, abnormal	chd7^sr5/sr5	standard conditions	FIGURE 3 from Sun et al., 2022
whole organism chd7 expression decreased amount, abnormal	chd7^sr5/+	standard conditions	FIGURE 2 from Sun et al., 2022
bulbus arteriosus shape, abnormal	chd7^sr5/+; el818Tg; hu7185Tg; ncv22Tg; zf384Tg	standard conditions	FIGURE 5 from Sun et al., 2022
aortic arch 3 displaced to opercular artery, abnormal	chd7^sr5/+; hu7185Tg	standard conditions	FIGURE 4 from Sun et al., 2022
aortic arch 3 branched, abnormal	chd7^sr5/+; hu7185Tg	standard conditions	FIGURE 4 from Sun et al., 2022
aortic arch 3 asymmetrical, abnormal	chd7^sr5/+; hu7185Tg	standard conditions	FIGURE 4 from Sun et al., 2022
bulbus arteriosus elongated, abnormal	chd7^sr5/sr5; el818Tg; hu7185Tg; ncv22Tg; zf384Tg	standard conditions	FIGURE 5 from Sun et al., 2022
bulbus arteriosus decreased width, abnormal	chd7^sr5/sr5; el818Tg; hu7185Tg; ncv22Tg; zf384Tg	standard conditions	FIGURE 5 from Sun et al., 2022
aortic arch 3 morphology, abnormal	chd7^sr5/sr5; hu7185Tg	standard conditions	FIGURE 4 from Sun et al., 2022
aortic arch 3 displaced to opercular artery, abnormal	chd7^sr5/sr5; hu7185Tg	standard conditions	FIGURE 4 from Sun et al., 2022
aortic arch 3 morphology, abnormal	chd7^sr5/sr5; hu7185Tg	standard conditions	FIGURE 4 from Sun et al., 2022
aortic arch 3 decreased diameter, abnormal	chd7^sr5/sr5; hu7185Tg	standard conditions	FIGURE 4 from Sun et al., 2022
pharyngeal arch artery morphogenesis process quality, abnormal	chd7^sr5/sr5; hu7185Tg	standard conditions	FIGURE 4 from Sun et al., 2022
ventral aorta decreased length, abnormal	chd7^sr5/sr5; hu7185Tg	standard conditions	FIGURE 4 from Sun et al., 2022
ventral aorta decreased length, abnormal	chd7^sr5/sr5; hu7185Tg	standard conditions	FIGURE 4 from Sun et al., 2022
opercular artery morphology, abnormal	chd7^sr5/sr5; hu7185Tg	standard conditions	FIGURE 4 from Sun et al., 2022
aortic arch 3 branched, abnormal	chd7^sr5/sr5; hu7185Tg	standard conditions	FIGURE 4 from Sun et al., 2022
aortic arch 3 asymmetrical, abnormal	chd7^sr5/sr5; hu7185Tg	standard conditions	FIGURE 4 from Sun et al., 2022
opercular artery decreased diameter, abnormal	chd7^sr5/sr5; hu7185Tg	standard conditions	FIGURE 4 from Sun et al., 2022
aortic arch 3 branched, abnormal	chd7^sr5/sr5; hu7185Tg	standard conditions	FIGURE 4 from Sun et al., 2022
aortic arch 3 asymmetrical, abnormal	chd7^sr5/sr5; hu7185Tg	standard conditions	FIGURE 4 from Sun et al., 2022

Citations