CRISPR

CRISPR4-lrp5

ID
ZDB-CRISPR-230207-1
Name
CRISPR4-lrp5
Previous Names
None
Target
Sequence
5' - GGGTCGCTCAGAGTCTGCAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
biu102 lrp5
Expression
Gene expression in Wild Types + CRISPR4-lrp5
No data available
Phenotype
Phenotype resulting from CRISPR4-lrp5
No data available
Phenotype of all Fish created by or utilizing CRISPR4-lrp5
Phenotype Fish Conditions Figures
lepidotrichium proximal side bifurcated, abnormal lrp5biu102/biu102 (AB) standard conditions Figure 6 with image from Khrystoforova et al., 2022
cranial vault bone mineralization decreased process quality, abnormal lrp5biu102/biu102 (AB) standard conditions Figure 2 with image from Khrystoforova et al., 2022
cranium mef2d expression increased amount, abnormal lrp5biu102/biu102 (AB) standard conditions Figure 5 with image from Khrystoforova et al., 2022
cranium mmp9 expression increased amount, abnormal lrp5biu102/biu102 (AB) standard conditions Figure 5 with image from Khrystoforova et al., 2022
vertebral column curved, abnormal lrp5biu102/biu102 (AB) standard conditions Figure 2 with image from Khrystoforova et al., 2022
vertebral column kinked, abnormal lrp5biu102/biu102 (AB) standard conditions Figure 2 with image from Khrystoforova et al., 2022
opercle bone mineralization decreased process quality, abnormal lrp5biu102/biu102 (AB) standard conditions Figure 2 with image from Khrystoforova et al., 2022
skeletal tissue decreased mass density, abnormal lrp5biu102/biu102 (AB) standard conditions Figure 2 with image from Khrystoforova et al., 2022
whole organism viability, abnormal lrp5biu102/biu102 (AB) standard conditions Figure 1 with image from Khrystoforova et al., 2022
whole organism decreased life span, abnormal lrp5biu102/biu102 (AB) standard conditions Figure 1 with image from Khrystoforova et al., 2022
cranial vault decreased mass density, abnormal lrp5biu102/biu102 (AB) standard conditions Figure 2 with image from Khrystoforova et al., 2022
scale bone mineralization decreased process quality, abnormal lrp5biu102/biu102 (AB) standard conditions Figure 6 with image from Khrystoforova et al., 2022
cranium map3k5 expression increased amount, abnormal lrp5biu102/biu102 (AB) standard conditions Figure 5 with image from Khrystoforova et al., 2022
ventral mandibular arch bone mineralization decreased process quality, abnormal lrp5biu102/biu102 (AB) standard conditions Figure 2 with image from Khrystoforova et al., 2022
scale osteoclast active, abnormal lrp5biu102/biu102 (AB) standard conditions Figure 6 with image from Khrystoforova et al., 2022
caudal fin Ab1-lrp5 labeling absent, abnormal lrp5biu102/biu102 (AB) standard conditions Figure 1 with image from Khrystoforova et al., 2022
cranium mmp13a expression increased amount, abnormal lrp5biu102/biu102 (AB) standard conditions Figure 5 with image from Khrystoforova et al., 2022
nasal bone increased angle to mouth, abnormal lrp5biu102/biu102 (AB) standard conditions Figure 3 with image from Khrystoforova et al., 2022
parasphenoid decreased length, abnormal lrp5biu102/biu102 (AB) standard conditions Figure 3 with image from Khrystoforova et al., 2022
parasphenoid malformed, abnormal lrp5biu102/biu102 (AB) standard conditions Figure 3 with image from Khrystoforova et al., 2022
cranium acp5a expression increased amount, abnormal lrp5biu102/biu102 (AB) standard conditions Figure 5 with image from Khrystoforova et al., 2022
head deformed, abnormal lrp5biu102/biu102 (AB) standard conditions Figure 2 with image from Khrystoforova et al., 2022
Citations