CRISPR

CRISPR1-rab25b

ID
ZDB-CRISPR-220309-4
Name
CRISPR1-rab25b
Previous Names
None
Target
Sequence
5' - GTGCGCTCCGTTCCTACAGAGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
uot11 rab25b
Expression
Gene expression in Wild Types + CRISPR1-rab25b
No data available
Phenotype
Phenotype resulting from CRISPR1-rab25b
No data available
Phenotype of all Fish created by or utilizing CRISPR1-rab25b
Phenotype Fish Conditions Figures
EVL recycling endosome increased diameter, abnormal rab25buot11/uot11 control Figure 7—figure supplement 2. with image from Willoughby et al., 2021
EVL cytokinesis disrupted, abnormal rab25buot11/uot11 control Figure 3. with imageFigure 4 with image from Willoughby et al., 2021
epiboly delayed, abnormal rab25buot11/uot11 standard conditions Figure 2 with imageFigure 2—figure supplement 1. with image from Willoughby et al., 2021
EVL apical part of cell increased size, abnormal rab25buot11/uot11 standard conditions Figure 2 with image from Willoughby et al., 2021
EVL intercellular bridge increased length, abnormal rab25buot11/uot11 control Figure 3. with image from Willoughby et al., 2021
EVL contractile ring contraction disrupted, abnormal rab25buot11/uot11 standard conditions Figure 4 with imageFigure 4—figure supplement 1. with image from Willoughby et al., 2021
EVL abscission delayed, abnormal rab25buot11/uot11 control Figure 3. with image from Willoughby et al., 2021
forerunner cell group disorganized, abnormal rab25buot11/uot11 standard conditions Figure 2—figure supplement 1. with image from Willoughby et al., 2021
DEL epiboly delayed, abnormal rab25buot11/uot11 standard conditions Figure 2—figure supplement 1. with image from Willoughby et al., 2021
EVL cell disorganized, abnormal rab25buot11/uot11 control Figure 5 with image from Willoughby et al., 2021
EVL cell decreased size, abnormal rab25buot11/uot11 standard conditions Figure 2 with image from Willoughby et al., 2021
EVL cell morphology, abnormal rab25buot11/uot11 standard conditions Figure 2 with imageFigure 2—figure supplement 2. with image from Willoughby et al., 2021
EVL cell increased size, abnormal rab25buot11/uot11 standard conditions Figure 2 with image from Willoughby et al., 2021
EVL spindle disoriented, abnormal rab25buot11/uot11 control Figure 4—figure supplement 1. with image from Willoughby et al., 2021
EVL endocytic recycling decreased process quality, abnormal rab25buot11/uot11 control Figure 7 with image from Willoughby et al., 2021
EVL apical part of cell decreased size, abnormal rab25buot11/uot11 control Figure 2 with imageFigure 4 with image from Willoughby et al., 2021
EVL epiboly delayed, abnormal rab25buot11/uot11 standard conditions Figure 2—figure supplement 1. with image from Willoughby et al., 2021
EVL cell-cell junction ab1-myl-ser19-p labeling decreased amount, abnormal rab25buot11/uot11 standard conditions Figure 6 with image from Willoughby et al., 2021
EVL intercellular bridge organization increased duration, abnormal rab25buot11/uot11 control Figure 3. with image from Willoughby et al., 2021
EVL intercellular bridge decreased stability, abnormal rab25buot11/uot11 control Figure 3. with image from Willoughby et al., 2021
EVL cortical actin cytoskeleton decreased amount, abnormal rab25buot11/uot11 standard conditions Figure 6 with imageFigure 6—figure supplement 1. with image from Willoughby et al., 2021
yolk cytoskeleton disorganized, abnormal rab25buot11/uot11 standard conditions Figure 2 with image from Willoughby et al., 2021
blastomere morphology, abnormal rab25buot11/uot11 standard conditions Figure 2—figure supplement 1. with image from Willoughby et al., 2021
EVL cell mosaicism, abnormal rab25buot11/uot11 standard conditions Figure 2 with image from Willoughby et al., 2021
EVL cell decreased amount, abnormal rab25buot11/uot11 standard conditions Figure 2 with image from Willoughby et al., 2021
epiboly process quality, ameliorated rab25buot11/uot11; uot16Tg standard conditions Figure 2—figure supplement 1. with image from Willoughby et al., 2021
Citations