CRISPR

CRISPR2-fgfr3

ID

ZDB-CRISPR-210218-6

Name

CRISPR2-fgfr3

Previous Names

None

Target

fgfr3 (1)

Sequence

5' - GGGAGAGGGCTGCTTTGGGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "AGG" at the 3' end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zf3388	fgfr3
zf3389	fgfr3

Expression

Gene expression in Wild Types + CRISPR2-fgfr3

No data available

Phenotype

Phenotype resulting from CRISPR2-fgfr3

No data available

Phenotype of all Fish created by or utilizing CRISPR2-fgfr3

Phenotype	Fish	Conditions	Figures
pharyngeal arch 1 morphology, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 6 from Sun et al., 2020
intercalarium poorly ossified, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 6 from Sun et al., 2020
branchiostegal ray intramembranous ossification delayed, abnormal	fgfr3^{zf3388/zf3388} (AB)	control	Figure 9 from Sun et al., 2020
claustrum bone poorly ossified, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 6 from Sun et al., 2020
hypobranchial bone poorly ossified, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 6 from Sun et al., 2020
dentary intramembranous ossification delayed, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 6 from Sun et al., 2020
scaphium morphology, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 6 from Sun et al., 2020
tripus morphology, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 6 from Sun et al., 2020
ceratohyal cartilage chondrocyte size, ameliorated	fgfr3^{zf3388/zf3388} (AB)	chemical treatment by environment: XAV939	Figure 9 from Sun et al., 2020
ceratohyal bone chondrocyte size, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 5 from Sun et al., 2020
pharyngeal arch cartilage axin2 expression increased amount, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 9 from Sun et al., 2020
swim bladder anterior compartment attached to Weberian apparatus, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 3 from Sun et al., 2020
ceratohyal cartilage chondrocyte shape, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 7 , Figure 9 from Sun et al., 2020
Meckel's cartilage chondrocyte irregular spatial pattern, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 7 from Sun et al., 2020
basihyal cartilage ossification delayed, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 5 , Figure 6 from Sun et al., 2020
cranial vault domed, ameliorated	fgfr3^{zf3388/zf3388} (AB)	chemical treatment by environment: XAV939	Figure 9 from Sun et al., 2020
ceratohyal bone poorly ossified, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 6 from Sun et al., 2020
pharyngeal arch 2 morphology, ameliorated	fgfr3^{zf3388/zf3388} (AB)	chemical treatment by environment: XAV939	Figure 9 from Sun et al., 2020
basihyal bone chondrocyte disorganized, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 5 from Sun et al., 2020
ceratobranchial cartilage endochondral ossification delayed, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 6 from Sun et al., 2020
tripus decreased length, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 3 from Sun et al., 2020
Meckel's cartilage chondrocyte hypertrophic, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 7 from Sun et al., 2020
pharyngeal arch 2 asymmetrical, ameliorated	fgfr3^{zf3388/zf3388} (AB)	chemical treatment by environment: XAV939	Figure 9 from Sun et al., 2020
dentary poorly ossified, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 6 from Sun et al., 2020
intercalarium ossification delayed, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 6 from Sun et al., 2020
branchiostegal ray anatomical structure development delayed, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 4 from Sun et al., 2020
swim bladder absent, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 3 from Sun et al., 2020
ceratohyal cartilage ossification delayed, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 5 from Sun et al., 2020
Meckel's cartilage columnar chondrocyte disorganized, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 7 from Sun et al., 2020
ceratohyal cartilage chondrocyte size, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 7 , Figure 9 from Sun et al., 2020
opercle intramembranous ossification delayed, abnormal	fgfr3^{zf3388/zf3388} (AB)	control	Figure 6 , Figure 9 from Sun et al., 2020
frontal bone ossification delayed, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 4 from Sun et al., 2020
claustrum cartilage ossification delayed, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 6 from Sun et al., 2020
head decreased size, abnormal	fgfr3^{zf3388/zf3388} (AB)	control	Figure 9 from Sun et al., 2020
basihyal cartilage columnar chondrocyte disorganized, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 7 from Sun et al., 2020
basihyal bone chondrocyte polarity, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 5 from Sun et al., 2020
pharyngeal arch 2 drooping, ameliorated	fgfr3^{zf3388/zf3388} (AB)	chemical treatment by environment: XAV939	Figure 9 from Sun et al., 2020
head decreased size, ameliorated	fgfr3^{zf3388/zf3388} (AB)	chemical treatment by environment: XAV939	Figure 9 from Sun et al., 2020
whole organism Ab2-ihh labeling increased amount, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 9 from Sun et al., 2020
whole organism decreased length, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 3 from Sun et al., 2020
opercle poorly ossified, abnormal	fgfr3^{zf3388/zf3388} (AB)	control	Figure 6 , Figure 9 from Sun et al., 2020
trunk kinked, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 3 from Sun et al., 2020
tripus poorly ossified, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 6 from Sun et al., 2020
suspensorium decreased length, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 3 from Sun et al., 2020
basihyal cartilage chondrocyte irregular spatial pattern, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 7 from Sun et al., 2020
branchiostegal ray poorly ossified, abnormal	fgfr3^{zf3388/zf3388} (AB)	control	Figure 6 , Figure 9 from Sun et al., 2020
claustrum bone morphology, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 6 from Sun et al., 2020
ceratohyal bone ossification delayed, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 4 from Sun et al., 2020
retroarticular poorly ossified, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 6 from Sun et al., 2020
basihyal bone poorly ossified, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 6 from Sun et al., 2020
opercle poorly ossified, abnormal	fgfr3^{zf3388/zf3388} (AB)	chemical treatment by environment: XAV939	Figure 9 from Sun et al., 2020
basihyal cartilage chondrocyte hypertrophic, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 7 from Sun et al., 2020
palatoquadrate cartilage chondrocyte hypertrophic, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 7 from Sun et al., 2020
branchiostegal ray poorly ossified, abnormal	fgfr3^{zf3388/zf3388} (AB)	chemical treatment by environment: XAV939	Figure 9 from Sun et al., 2020
osteoblast proliferation decreased occurrence, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 8 from Sun et al., 2020
ceratohyal bone chondrocyte polarity, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 5 from Sun et al., 2020
cranial vault deformed, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 3 from Sun et al., 2020
scale mineralized, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Fig. S5 from Sun et al., 2020
basihyal bone chondrocyte size, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 5 , Figure 7 from Sun et al., 2020
opercle intramembranous ossification delayed, abnormal	fgfr3^{zf3388/zf3388} (AB)	chemical treatment by environment: XAV939	Figure 9 from Sun et al., 2020
precaudal vertebra adjacent to rib, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 3 from Sun et al., 2020
ceratohyal cartilage chondrocyte position, ameliorated	fgfr3^{zf3388/zf3388} (AB)	chemical treatment by environment: XAV939	Figure 9 from Sun et al., 2020
mandibular arch skeleton asymmetrical, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 3 from Sun et al., 2020
intercalarium morphology, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 6 from Sun et al., 2020
chondrocyte proliferation increased occurrence, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 8 from Sun et al., 2020
whole organism Ab17-ctnnb labeling increased amount, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 9 from Sun et al., 2020
Weberian apparatus morphology, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 3 from Sun et al., 2020
pharyngeal arch 2 drooping, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 3 , Figure 9 from Sun et al., 2020
swim bladder circular, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 3 from Sun et al., 2020
whole organism fgfr3 expression decreased amount, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 3 from Sun et al., 2020
parietal bone ossification delayed, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 4 from Sun et al., 2020
cranial vault domed, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 3 , Figure 9 from Sun et al., 2020
ceratohyal cartilage perichondral ossification delayed, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 5 from Sun et al., 2020
ceratohyal cartilage chondrocyte mislocalised, abnormal	fgfr3^{zf3388/zf3388} (AB)	control	Figure 9 from Sun et al., 2020
retroarticular endochondral ossification delayed, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 6 from Sun et al., 2020
pharyngeal arch 2 asymmetrical, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 4 , Figure 6 , Figure 9 from Sun et al., 2020
palatoquadrate cartilage endochondral ossification delayed, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 6 from Sun et al., 2020
ceratohyal cartilage increased length, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 6 from Sun et al., 2020
intramembranous bone ossification decreased magnitude, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 4 from Sun et al., 2020
ceratohyal bone chondrocyte disorganized, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 5 from Sun et al., 2020
branchiostegal ray ossification delayed, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 4 , Figure 6 , Figure 9 from Sun et al., 2020
scaphium poorly ossified, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 6 from Sun et al., 2020
branchiostegal ray ossification delayed, abnormal	fgfr3^{zf3388/zf3388} (AB)	chemical treatment by environment: XAV939	Figure 9 from Sun et al., 2020
mandibular arch skeleton malformed, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 3 from Sun et al., 2020
scaphium ossification delayed, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 6 from Sun et al., 2020
branchiostegal ray intramembranous ossification delayed, abnormal	fgfr3^{zf3388/zf3388} (AB)	chemical treatment by environment: XAV939	Figure 9 from Sun et al., 2020
pharyngeal arch 2 morphology, abnormal	fgfr3^{zf3388/zf3388} (AB)	control	Figure 6 , Figure 9 from Sun et al., 2020
cranium closure incomplete, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 3 from Sun et al., 2020
gill exposed, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 4 from Sun et al., 2020
hypobranchial cartilage endochondral ossification delayed, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 6 from Sun et al., 2020
tripus ossification delayed, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 6 from Sun et al., 2020
ceratohyal cartilage chondrocyte shape, ameliorated	fgfr3^{zf3388/zf3388} (AB)	chemical treatment by environment: XAV939	Figure 9 from Sun et al., 2020
chondrocyte collagen network disorganized, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Figure 7 from Sun et al., 2020
scale decreased amount, abnormal	fgfr3^{zf3388/zf3388} (AB)	standard conditions	Fig. S5 from Sun et al., 2020
branchiostegal ray intramembranous ossification delayed, abnormal	fgfr3^{zf3389/zf3389} (AB)	control	Figure 9 from Sun et al., 2020
pharyngeal arch 1 morphology, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 6 from Sun et al., 2020
dentary intramembranous ossification delayed, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 6 from Sun et al., 2020
hypobranchial bone poorly ossified, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 6 from Sun et al., 2020
intercalarium poorly ossified, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 6 from Sun et al., 2020
scaphium morphology, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 6 from Sun et al., 2020
claustrum bone poorly ossified, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 6 from Sun et al., 2020
ceratohyal bone chondrocyte size, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 5 from Sun et al., 2020
ceratohyal cartilage chondrocyte size, ameliorated	fgfr3^{zf3389/zf3389} (AB)	chemical treatment by environment: XAV939	Figure 9 from Sun et al., 2020
pharyngeal arch cartilage axin2 expression increased amount, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 9 from Sun et al., 2020
Meckel's cartilage chondrocyte irregular spatial pattern, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 7 from Sun et al., 2020
swim bladder anterior compartment attached to Weberian apparatus, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 3 from Sun et al., 2020
basihyal cartilage ossification delayed, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 5 , Figure 6 from Sun et al., 2020
cranial vault domed, ameliorated	fgfr3^{zf3389/zf3389} (AB)	chemical treatment by environment: XAV939	Figure 9 from Sun et al., 2020
tripus morphology, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 6 from Sun et al., 2020
basihyal bone chondrocyte disorganized, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 5 from Sun et al., 2020
pharyngeal arch 2 morphology, ameliorated	fgfr3^{zf3389/zf3389} (AB)	chemical treatment by environment: XAV939	Figure 9 from Sun et al., 2020
ceratobranchial cartilage endochondral ossification delayed, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 6 from Sun et al., 2020
tripus decreased length, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 3 from Sun et al., 2020
ceratohyal cartilage chondrocyte size, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 7 , Figure 9 from Sun et al., 2020
Meckel's cartilage chondrocyte hypertrophic, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 7 from Sun et al., 2020
intercalarium ossification delayed, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 6 from Sun et al., 2020
dentary poorly ossified, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 6 from Sun et al., 2020
pharyngeal arch 2 asymmetrical, ameliorated	fgfr3^{zf3389/zf3389} (AB)	chemical treatment by environment: XAV939	Figure 9 from Sun et al., 2020
swim bladder absent, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 3 from Sun et al., 2020
ceratohyal cartilage ossification delayed, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 5 from Sun et al., 2020
Meckel's cartilage columnar chondrocyte disorganized, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 7 from Sun et al., 2020
opercle intramembranous ossification delayed, abnormal	fgfr3^{zf3389/zf3389} (AB)	control	Figure 6 , Figure 9 from Sun et al., 2020
head decreased size, abnormal	fgfr3^{zf3389/zf3389} (AB)	control	Figure 9 from Sun et al., 2020
basihyal bone chondrocyte polarity, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 5 from Sun et al., 2020
pharyngeal arch 2 drooping, ameliorated	fgfr3^{zf3389/zf3389} (AB)	chemical treatment by environment: XAV939	Figure 9 from Sun et al., 2020
basihyal cartilage columnar chondrocyte disorganized, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 7 from Sun et al., 2020
whole organism decreased length, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 3 from Sun et al., 2020
whole organism Ab2-ihh labeling increased amount, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 9 from Sun et al., 2020
head decreased size, ameliorated	fgfr3^{zf3389/zf3389} (AB)	chemical treatment by environment: XAV939	Figure 9 from Sun et al., 2020
opercle intramembranous ossification delayed, abnormal	fgfr3^{zf3389/zf3389} (AB)	chemical treatment by environment: XAV939	Figure 9 from Sun et al., 2020
opercle poorly ossified, abnormal	fgfr3^{zf3389/zf3389} (AB)	control	Figure 6 , Figure 9 from Sun et al., 2020
ceratohyal bone poorly ossified, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 6 from Sun et al., 2020
trunk kinked, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 3 from Sun et al., 2020
tripus poorly ossified, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 6 from Sun et al., 2020
branchiostegal ray poorly ossified, abnormal	fgfr3^{zf3389/zf3389} (AB)	control	Figure 6 , Figure 9 from Sun et al., 2020
basihyal cartilage chondrocyte irregular spatial pattern, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 7 from Sun et al., 2020
suspensorium decreased length, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 3 from Sun et al., 2020
claustrum cartilage ossification delayed, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 6 from Sun et al., 2020
claustrum bone morphology, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 6 from Sun et al., 2020
retroarticular poorly ossified, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 6 from Sun et al., 2020
basihyal bone poorly ossified, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 6 from Sun et al., 2020
basihyal cartilage chondrocyte hypertrophic, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 7 from Sun et al., 2020
opercle poorly ossified, abnormal	fgfr3^{zf3389/zf3389} (AB)	chemical treatment by environment: XAV939	Figure 9 from Sun et al., 2020
branchiostegal ray poorly ossified, abnormal	fgfr3^{zf3389/zf3389} (AB)	chemical treatment by environment: XAV939	Figure 9 from Sun et al., 2020
palatoquadrate cartilage chondrocyte hypertrophic, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 7 from Sun et al., 2020
osteoblast proliferation decreased occurrence, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 8 from Sun et al., 2020
ceratohyal bone chondrocyte polarity, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 5 from Sun et al., 2020
cranial vault deformed, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 3 from Sun et al., 2020
basihyal bone chondrocyte size, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 5 , Figure 7 from Sun et al., 2020
precaudal vertebra adjacent to rib, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 3 from Sun et al., 2020
intercalarium morphology, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 6 from Sun et al., 2020
chondrocyte proliferation increased occurrence, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 8 from Sun et al., 2020
whole organism Ab17-ctnnb labeling increased amount, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 9 from Sun et al., 2020
mandibular arch skeleton asymmetrical, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 3 from Sun et al., 2020
pharyngeal arch 2 drooping, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 3 , Figure 9 from Sun et al., 2020
Weberian apparatus morphology, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 3 from Sun et al., 2020
swim bladder circular, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 3 from Sun et al., 2020
ceratohyal cartilage chondrocyte position, ameliorated	fgfr3^{zf3389/zf3389} (AB)	chemical treatment by environment: XAV939	Figure 9 from Sun et al., 2020
whole organism fgfr3 expression decreased amount, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 3 from Sun et al., 2020
cranial vault domed, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 3 , Figure 9 from Sun et al., 2020
ceratohyal cartilage perichondral ossification delayed, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 5 from Sun et al., 2020
ceratohyal cartilage chondrocyte mislocalised, abnormal	fgfr3^{zf3389/zf3389} (AB)	control	Figure 9 from Sun et al., 2020
retroarticular endochondral ossification delayed, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 6 from Sun et al., 2020
palatoquadrate cartilage endochondral ossification delayed, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 6 from Sun et al., 2020
pharyngeal arch 2 asymmetrical, abnormal	fgfr3^{zf3389/zf3389} (AB)	control	Figure 6 , Figure 9 from Sun et al., 2020
ceratohyal bone chondrocyte disorganized, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 5 from Sun et al., 2020
branchiostegal ray ossification delayed, abnormal	fgfr3^{zf3389/zf3389} (AB)	control	Figure 6 , Figure 9 from Sun et al., 2020
scaphium poorly ossified, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 6 from Sun et al., 2020
mandibular arch skeleton malformed, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 3 from Sun et al., 2020
branchiostegal ray ossification delayed, abnormal	fgfr3^{zf3389/zf3389} (AB)	chemical treatment by environment: XAV939	Figure 9 from Sun et al., 2020
cranium closure incomplete, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 3 from Sun et al., 2020
hypobranchial cartilage endochondral ossification delayed, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 6 from Sun et al., 2020
pharyngeal arch 2 morphology, abnormal	fgfr3^{zf3389/zf3389} (AB)	control	Figure 6 , Figure 9 from Sun et al., 2020
branchiostegal ray intramembranous ossification delayed, abnormal	fgfr3^{zf3389/zf3389} (AB)	chemical treatment by environment: XAV939	Figure 9 from Sun et al., 2020
tripus ossification delayed, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 6 from Sun et al., 2020
ceratohyal cartilage chondrocyte shape, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 7 , Figure 9 from Sun et al., 2020
scaphium ossification delayed, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 6 from Sun et al., 2020
ceratohyal cartilage chondrocyte shape, ameliorated	fgfr3^{zf3389/zf3389} (AB)	chemical treatment by environment: XAV939	Figure 9 from Sun et al., 2020
chondrocyte collagen network disorganized, abnormal	fgfr3^{zf3389/zf3389} (AB)	standard conditions	Figure 7 from Sun et al., 2020

Citations