CRISPR

CRISPR1-hcfc1a

ID
ZDB-CRISPR-210125-1
Name
CRISPR1-hcfc1a
Previous Names
None
Target
Sequence
5' - GGTTCATACCAGCCGTTCGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
co60 hcfc1a
co64 hcfc1a
Expression
Gene expression in Wild Types + CRISPR1-hcfc1a
No data available
Phenotype
Phenotype resulting from CRISPR1-hcfc1a
No data available
Phenotype of all Fish created by or utilizing CRISPR1-hcfc1a
Phenotype Fish Conditions Figures
brain ccne1 expression decreased amount, abnormal hcfc1aco60/+ chemical treatment by environment: EC 2.7.1.137 (phosphatidylinositol 3-kinase) inhibitor Fig. 9 with image from Castro et al., 2020
brain neuronal stem cell apoptotic, abnormal hcfc1aco60/+ standard conditions Fig. 4 with image from Castro et al., 2020
brain neural precursor cell proliferation increased occurrence, abnormal hcfc1aco60/+ control Fig. 9 with image from Castro et al., 2020
brain neuronal stem cell increased amount, abnormal hcfc1aco60/+ control Fig. 3 with imageFig. 4 with imageFig. 8 with imageFig. 9 with image from Castro et al., 2020
forebrain neuronal stem cell increased amount, abnormal hcfc1aco60/+ standard conditions Fig. 2 with image from Castro et al., 2020
brain sox2 expression decreased amount, abnormal hcfc1aco60/+ chemical treatment by environment: EC 2.7.1.137 (phosphatidylinositol 3-kinase) inhibitor Fig. 9 with image from Castro et al., 2020
brain glial cell gfap expression increased amount, abnormal hcfc1aco60/+ standard conditions Fig. 5 with image from Castro et al., 2020
whole organism sox2 expression increased amount, abnormal hcfc1aco60/+ standard conditions Fig. 2 with image from Castro et al., 2020
hindbrain neural precursor cell proliferation normal occurrence, ameliorated hcfc1aco60/+ chemical treatment by environment: EC 2.7.1.137 (phosphatidylinositol 3-kinase) inhibitor Fig. 8 with image from Castro et al., 2020
midbrain neural precursor cell proliferation increased occurrence, abnormal hcfc1aco60/+ control Fig. 4 with imageFig. 8 with image from Castro et al., 2020
midbrain neuronal stem cell increased amount, abnormal hcfc1aco60/+ standard conditions Fig. 2 with image from Castro et al., 2020
hindbrain neural precursor cell proliferation increased occurrence, abnormal hcfc1aco60/+ control Fig. 4 with imageFig. 8 with image from Castro et al., 2020
brain neuron elavl3 expression increased amount, abnormal hcfc1aco60/+ standard conditions Fig. 5 with image from Castro et al., 2020
hindbrain cell proliferation in hindbrain increased occurrence, abnormal hcfc1aco60/+ standard conditions Fig. 7 with image from Castro et al., 2020
midbrain neural precursor cell proliferation normal occurrence, ameliorated hcfc1aco60/+ chemical treatment by environment: EC 2.7.1.137 (phosphatidylinositol 3-kinase) inhibitor Fig. 8 with image from Castro et al., 2020
brain ccne1 expression increased amount, abnormal hcfc1aco60/+ control Fig. 9 with image from Castro et al., 2020
forebrain neural precursor cell proliferation normal occurrence, ameliorated hcfc1aco60/+ chemical treatment by environment: EC 2.7.1.137 (phosphatidylinositol 3-kinase) inhibitor Fig. 8 with image from Castro et al., 2020
whole organism hcfc1a expression decreased amount, abnormal hcfc1aco60/+ standard conditions Fig. 1 with image from Castro et al., 2020
forebrain neural precursor cell proliferation increased occurrence, abnormal hcfc1aco60/+ control Fig. 8 with image from Castro et al., 2020
forebrain cell proliferation in forebrain increased occurrence, abnormal hcfc1aco60/+ standard conditions Fig. 7 with image from Castro et al., 2020
whole organism asxl1 expression increased amount, abnormal hcfc1aco60/+ standard conditions Fig. 7 with image from Castro et al., 2020
brain olig2 expression increased amount, abnormal hcfc1aco60/+ standard conditions Fig. 5 with image from Castro et al., 2020
brain neural precursor cell proliferation normal occurrence, ameliorated hcfc1aco60/+ chemical treatment by environment: EC 2.7.1.137 (phosphatidylinositol 3-kinase) inhibitor Fig. 9 with image from Castro et al., 2020
neuronal stem cell apoptotic process increased occurrence, abnormal hcfc1aco60/+ standard conditions Fig. 4 with image from Castro et al., 2020
hindbrain neuronal stem cell increased amount, abnormal hcfc1aco60/+ standard conditions Fig. 2 with image from Castro et al., 2020
brain neuronal stem cell normal amount, ameliorated hcfc1aco60/+ chemical treatment by environment: EC 2.7.1.137 (phosphatidylinositol 3-kinase) inhibitor Fig. 9 with image from Castro et al., 2020
brain sox2 expression increased amount, abnormal hcfc1aco60/+ control Fig. 9 with image from Castro et al., 2020
brain asxl1 expression increased amount, abnormal hcfc1aco60/+ control Fig. 9 with image from Castro et al., 2020
midbrain cell proliferation in midbrain increased occurrence, abnormal hcfc1aco60/+ standard conditions Fig. 7 with image from Castro et al., 2020
swimming decreased occurrence, abnormal hcfc1aco60/+ standard conditions Fig. 10 with image from Castro et al., 2020
brain asxl1 expression decreased amount, abnormal hcfc1aco60/+ chemical treatment by environment: EC 2.7.1.137 (phosphatidylinositol 3-kinase) inhibitor Fig. 9 with image from Castro et al., 2020
forebrain cell proliferation in forebrain normal occurrence, ameliorated hcfc1aco60/+ + MO2-asxl1 standard conditions Fig. 7 with image from Castro et al., 2020
hindbrain cell proliferation in hindbrain normal occurrence, ameliorated hcfc1aco60/+ + MO2-asxl1 standard conditions Fig. 7 with image from Castro et al., 2020
midbrain cell proliferation in midbrain normal occurrence, ameliorated hcfc1aco60/+ + MO2-asxl1 standard conditions Fig. 7 with image from Castro et al., 2020
Citations