CRISPR

CRISPR2-sost

ID

ZDB-CRISPR-190918-3

Name

CRISPR2-sost

Previous Names

None

Target

sost (1)

Sequence

5' - GGGCGAAGAACGGTGGAAGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
w215Tg	sost
w216Tg	sost

Expression

Gene expression in Wild Types + CRISPR2-sost

No data available

Phenotype

Phenotype resulting from CRISPR2-sost

No data available

Phenotype of all Fish created by or utilizing CRISPR2-sost

Phenotype	Fish	Conditions	Figures
neuromast hair cell increased amount, abnormal	sost^w215Tg; s356tTg	chemical treatment by environment: LY-411575, chemical treatment by environment: neomycin, chemical ablation: neuromast hair cell	Fig. 4 from Thomas et al., 2019
neuromast support cell cell population proliferation increased occurrence, abnormal	sost^w215Tg; s356tTg	chemical treatment by environment: neomycin, chemical ablation: neuromast hair cell	Fig. 3 from Thomas et al., 2019
neuromast hair cell cell population proliferation increased occurrence, abnormal	sost^w215Tg; s356tTg	chemical treatment by environment: neomycin, chemical ablation: neuromast hair cell	Fig. 3 from Thomas et al., 2019
neuromast hair cell cell population proliferation increased occurrence, abnormal	sost^w215Tg; s356tTg	chemical treatment by environment: LY-411575, chemical treatment by environment: neomycin, chemical ablation: neuromast hair cell	Fig. 4 from Thomas et al., 2019
neuromast hair cell amount, abnormal	sost^w216Tg	chemical ablation: neuromast support cell, chemical treatment by environment: neomycin, chemical treatment by environment: LY-411575, chemical treatment by environment: metronidazole, chemical ablation: neuromast hair cell	Fig. 7 from Thomas et al., 2019
neuromast hair cell increased amount, abnormal	sost^w216Tg	chemical treatment by environment: LY-411575, chemical treatment by environment: neomycin, chemical ablation: neuromast hair cell	Fig. 7 from Thomas et al., 2019
neuromast hair cell decreased amount, abnormal	sost^w216Tg	chemical ablation: neuromast support cell, chemical treatment by environment: neomycin, chemical treatment by environment: metronidazole, chemical ablation: neuromast hair cell	Fig. 7 from Thomas et al., 2019
neuromast GFP expression increased distribution, abnormal	sost^w216Tg	chemical ablation: neuromast support cell, chemical treatment by environment: metronidazole	Fig. 10 from Thomas et al., 2019
neuromast Eos expression increased distribution, abnormal	sost^w215Tg; sost^w216Tg	chemical ablation: neuromast support cell, chemical treatment by environment: metronidazole	Fig. 5 from Thomas et al., 2019
neuromast Eos expression decreased distribution, abnormal	sost^w215Tg; sost^w216Tg	chemical ablation: neuromast support cell, chemical treatment by environment: neomycin, chemical treatment by environment: metronidazole, chemical ablation: neuromast hair cell	Fig. 6 from Thomas et al., 2019
neuromast hair cell decreased amount, abnormal	sost^w215Tg; sost^w216Tg	chemical ablation: neuromast support cell, chemical treatment by environment: neomycin, chemical treatment by environment: metronidazole, chemical ablation: neuromast hair cell	Fig. 6 from Thomas et al., 2019
neuromast hair cell decreased amount, abnormal	sost^w216Tg; tnfsf10l3^w218Tg	chemical ablation: neuromast support cell, chemical treatment by environment: neomycin, chemical treatment by environment: metronidazole, chemical ablation: neuromast hair cell	Fig. 9 from Thomas et al., 2019
neuromast Eos expression increased distribution, abnormal	sost^w216Tg; tnfsf10l3^w218Tg	chemical ablation: neuromast support cell, chemical treatment by environment: neomycin, chemical treatment by environment: metronidazole, chemical ablation: neuromast hair cell	Fig. 9 from Thomas et al., 2019

Citations