CRISPR

CRISPR1-reln

ID

ZDB-CRISPR-190107-1

Name

CRISPR1-reln

Previous Names

None

Target

reln (1)

Sequence

5' - GGAGCAGGACGAGTGGGCGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
nub23	reln

Expression

Gene expression in Wild Types + CRISPR1-reln

No data available

Phenotype

Phenotype resulting from CRISPR1-reln

No data available

Phenotype of all Fish created by or utilizing CRISPR1-reln

Phenotype	Fish	Conditions	Figures
stratum marginale reln expression absent, abnormal	reln^nub23/nub23 (AB)	standard conditions	Fig. 8 from Nimura et al., 2019
Purkinje cell neuron projection disoriented, abnormal	reln^nub23/nub23 (AB)	standard conditions	Fig. 7 from Nimura et al., 2019
cerebellar granule cell reln expression absent, abnormal	reln^nub23/nub23 (AB)	standard conditions	Fig. 8 from Nimura et al., 2019
granular layer corpus cerebelli has extra parts of type Purkinje cell, abnormal	reln^nub23/nub23 (AB)	standard conditions	Fig. 2 , Fig. 3 , Fig. 7 from Nimura et al., 2019
cerebellar Purkinje cell layer morphogenesis decreased occurrence, abnormal	reln^nub23/nub23 (AB)	standard conditions	Fig. 2 , Fig. 7 from Nimura et al., 2019
cerebellar crest reln expression absent, abnormal	reln^nub23/nub23 (AB)	standard conditions	Fig. 8 from Nimura et al., 2019
torus longitudinalis granule cell reln expression absent, abnormal	reln^nub23/nub23 (AB)	standard conditions	Fig. 8 from Nimura et al., 2019
molecular layer corpus cerebelli reln expression absent, abnormal	reln^nub23/nub23 (AB)	standard conditions	Fig. 8 from Nimura et al., 2019
stratum opticum reln expression absent, abnormal	reln^nub23/nub23 (AB)	standard conditions	Fig. 8 from Nimura et al., 2019
optic tectum neuron mislocalised radially, abnormal	reln^nub23/nub23 (AB)	standard conditions	Fig. 6 from Nimura et al., 2019
Purkinje cell inserted into granular layer corpus cerebelli, abnormal	reln^nub23/nub23 (AB)	standard conditions	Fig. 2 , Fig. 3 from Nimura et al., 2019
Purkinje cell layer corpus cerebelli has fewer parts of type Purkinje cell, abnormal	reln^nub23/nub23 (AB)	standard conditions	Fig. 2 from Nimura et al., 2019
granular layer corpus cerebelli has extra parts of type Purkinje cell, abnormal	reln^nub23/nub23; nkhspGFFDMC28CEt; nkuasgfp1aTg (AB)	standard conditions	Fig. 3 from Nimura et al., 2019
Purkinje cell inserted into granular layer corpus cerebelli, abnormal	reln^nub23/nub23; nkhspGFFDMC28CEt; nkuasgfp1aTg (AB)	standard conditions	Fig. 3 from Nimura et al., 2019
eurydendroid cell inserted into granular layer corpus cerebelli, abnormal	reln^nub23/nub23; nkhspGFFDMC156AEt; nkuasgfp1aTg (AB)	standard conditions	Fig. 4 from Nimura et al., 2019
granular layer corpus cerebelli has extra parts of type eurydendroid cell, abnormal	reln^nub23/nub23; nkhspGFFDMC156AEt; nkuasgfp1aTg (AB)	standard conditions	Fig. 4 from Nimura et al., 2019
Purkinje cell layer corpus cerebelli has fewer parts of type eurydendroid cell, abnormal	reln^nub23/nub23; nkhspGFFDMC156AEt; nkuasgfp1aTg (AB)	standard conditions	Fig. 4 from Nimura et al., 2019
Bergmann glial cell inserted into granular layer corpus cerebelli, abnormal	reln^nub23/nub23; nkSAGFFLF251AEt; nkuasgfp1aTg (AB)	standard conditions	Fig. 5 from Nimura et al., 2019
granular layer corpus cerebelli has extra parts of type Bergmann glial cell, abnormal	reln^nub23/nub23; nkSAGFFLF251AEt; nkuasgfp1aTg (AB)	standard conditions	Fig. 5 from Nimura et al., 2019

Citations