CRISPR

CRISPR2-gdf3

ID
ZDB-CRISPR-180515-6
Name
CRISPR2-gdf3
Previous Names
None
Target
Sequence
5' - GGGTCAGAAGACAGGCTCTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
a164 gdf3
a165 gdf3
pr05 gdf3
pr06 gdf3
pr11 gdf3
Expression
Gene expression in Wild Types + CRISPR2-gdf3
No data available
Phenotype
Phenotype resulting from CRISPR2-gdf3
No data available
Phenotype of all Fish created by or utilizing CRISPR2-gdf3
Phenotype Fish Conditions Figures
hypoblast sox32 expression decreased amount, abnormal gdf3a164/a164 (AB/TL) standard conditions Fig. 2 with image from Montague et al., 2017
margin tbxta expression decreased amount, abnormal gdf3a164/a164 (AB/TL) standard conditions Fig. 2 with image from Montague et al., 2017
margin gsc expression absent, abnormal gdf3a164/a164 (AB/TL) standard conditions Fig. 2 with image from Montague et al., 2017
heart position, abnormal gdf3a164/a164 (AB/TL) standard conditions Fig. 1-S2 with image from Montague et al., 2017
mesendoderm development decreased process quality, abnormal gdf3a164/a164 (AB/TL) standard conditions Fig. 2 with image from Montague et al., 2017
lateral plate mesoderm spaw expression mislocalised, abnormal gdf3a164/a164 (AB/TL) standard conditions Fig. 1-S2 with image from Montague et al., 2017
margin lft1 expression absent, abnormal gdf3a164/a164 (AB/TL) standard conditions Fig. 2 with image from Montague et al., 2017
heart position, abnormal gdf3a165/a165 (AB/TL) standard conditions Fig. 1-S2 with image from Montague et al., 2017
mesendoderm development decreased process quality, abnormal gdf3a165/a165 (AB/TL) standard conditions Fig. 2 with image from Montague et al., 2017
lateral plate mesoderm spaw expression mislocalised, abnormal gdf3a165/a165 (AB/TL) standard conditions Fig. 1-S2 with image from Montague et al., 2017
hypoblast sox32 expression decreased amount, abnormal gdf3a165/a165 (AB/TL) standard conditions Fig. 2 with image from Montague et al., 2017
margin tbxta expression decreased amount, abnormal gdf3a165/a165 (AB/TL) standard conditions Fig. 2 with image from Montague et al., 2017
margin gsc expression absent, abnormal gdf3a165/a165 (AB/TL) standard conditions Fig. 2 with image from Montague et al., 2017
margin lft1 expression absent, abnormal gdf3a165/a165 (AB/TL) standard conditions Fig. 2 with image from Montague et al., 2017
whole organism dorsal region foxa2 expression absent, abnormal gdf3pr05/pr05 standard conditions Fig. 2 with image from Pelliccia et al., 2017
whole organism dorsal region noto expression absent, abnormal gdf3pr05/pr05 standard conditions Fig. 2 with image from Pelliccia et al., 2017
margin dorsal region tbxta expression absent, abnormal gdf3pr05/pr05 standard conditions Fig. 2 with image from Pelliccia et al., 2017
mesoderm formation decreased occurrence, abnormal gdf3pr05/pr05 standard conditions Fig. 1 with image from Pelliccia et al., 2017
whole organism dorsal region chrd expression decreased distribution, abnormal gdf3pr05/pr05 standard conditions Fig. 3 with image from Pelliccia et al., 2017
margin sox17 expression absent, abnormal gdf3pr05/pr05 standard conditions Fig. 2 with image from Pelliccia et al., 2017
whole organism morphology, abnormal gdf3pr05/pr05 standard conditions Fig. 1 with image from Pelliccia et al., 2017
margin lft1 expression absent, abnormal gdf3pr05/pr05 standard conditions Fig. 2 with image from Pelliccia et al., 2017
margin ndr2 expression absent, abnormal gdf3pr05/pr05 standard conditions Fig. 2 with image from Pelliccia et al., 2017
whole organism dorsal region chrd expression decreased amount, abnormal gdf3pr05/pr05 standard conditions Fig. 3 with image from Pelliccia et al., 2017
whole organism dorsal region gsc expression absent, abnormal gdf3pr05/pr05 standard conditions Fig. 2 with image,  Fig. 3 with image from Pelliccia et al., 2017
whole organism ventral region ab1-smad labeling increased amount, abnormal gdf3pr05/pr05 standard conditions Fig. 3 with image from Pelliccia et al., 2017
whole organism ventral region eve1 expression increased amount, abnormal gdf3pr05/pr05 standard conditions Fig. 3 with image from Pelliccia et al., 2017
whole organism ventral region eve1 expression increased distribution, abnormal gdf3pr05/pr05 standard conditions Fig. 3 with image from Pelliccia et al., 2017
whole organism ventral region ab1-smad labeling increased distribution, abnormal gdf3pr05/pr05 standard conditions Fig. 3 with image from Pelliccia et al., 2017
endoderm formation decreased occurrence, abnormal gdf3pr05/pr05 standard conditions Fig. 1 with image from Pelliccia et al., 2017
embryonic structure ndr1 expression decreased amount, abnormal gdf3a164/+ (AB/TL) standard conditions Fig. 2 with image from Montague et al., 2017
whole organism lft1 expression decreased amount, abnormal gdf3a164/+ (AB/TL) standard conditions Fig. 2 with image from Montague et al., 2017
margin ndr1 expression decreased amount, abnormal gdf3a164/+ (AB/TL) standard conditions Fig. 2 with image from Montague et al., 2017
margin ndr2 expression decreased amount, abnormal gdf3a164/+ (AB/TL) standard conditions Fig. 2 with image from Montague et al., 2017
embryonic structure ndr2 expression decreased amount, abnormal gdf3a164/+ (AB/TL) standard conditions Fig. 2 with image from Montague et al., 2017
mesendoderm development decreased process quality, abnormal gdf3a164/+ (AB/TL) standard conditions Fig. 1 with image,  Fig. 2 with image from Montague et al., 2017
embryonic structure ndr1 expression decreased amount, abnormal gdf3a165/+ (AB/TL) standard conditions Fig. 2 with image from Montague et al., 2017
whole organism lft1 expression decreased amount, abnormal gdf3a165/+ (AB/TL) standard conditions Fig. 2 with image from Montague et al., 2017
margin ndr1 expression decreased amount, abnormal gdf3a165/+ (AB/TL) standard conditions Fig. 2 with image from Montague et al., 2017
margin ndr2 expression decreased amount, abnormal gdf3a165/+ (AB/TL) standard conditions Fig. 2 with image from Montague et al., 2017
mesendoderm development decreased process quality, abnormal gdf3a165/+ (AB/TL) standard conditions Fig. 1 with image,  Fig. 2 with image from Montague et al., 2017
embryonic structure ndr2 expression decreased amount, abnormal gdf3a165/+ (AB/TL) standard conditions Fig. 2 with image from Montague et al., 2017
margin ndr2 expression absent, abnormal gdf3pr05/+ standard conditions Fig. 2 with image from Pelliccia et al., 2017
margin lft1 expression absent, abnormal gdf3pr05/+ standard conditions Fig. 2 with image from Pelliccia et al., 2017
whole organism dorsal region gsc expression absent, abnormal gdf3pr05/+ standard conditions Fig. 2 with image from Pelliccia et al., 2017
whole organism morphology, abnormal gdf3pr05 standard conditions Fig. 1 with image from Pelliccia et al., 2017
mesoderm formation decreased occurrence, abnormal gdf3pr05 standard conditions Fig. 1 with image from Pelliccia et al., 2017
endoderm formation decreased occurrence, abnormal gdf3pr05 standard conditions Fig. 1 with image from Pelliccia et al., 2017
mesoderm formation decreased occurrence, abnormal gdf3pr05/pr05 + MO1-ndr2 + MO4-ndr1 standard conditions Fig. 3 with image from Pelliccia et al., 2017
caudal fin morphology, exacerbated gdf3pr05/pr05 + MO1-ndr2 + MO4-ndr1 standard conditions Fig. 3 with image from Pelliccia et al., 2017
endoderm formation decreased occurrence, abnormal gdf3pr05/pr05 + MO1-ndr2 + MO4-ndr1 standard conditions Fig. 3 with image from Pelliccia et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.