CRISPR

CRISPR1-gdf3

ID

ZDB-CRISPR-180515-5

Name

CRISPR1-gdf3

Previous Names

None

Target

gdf3 (1)

Sequence

5' - GGGTACGAGGAAACATCGTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
pr05	gdf3
pr06	gdf3
pr11	gdf3

Expression

Gene expression in Wild Types + CRISPR1-gdf3

No data available

Phenotype

Phenotype resulting from CRISPR1-gdf3

No data available

Phenotype of all Fish created by or utilizing CRISPR1-gdf3

Phenotype	Fish	Conditions	Figures
whole organism dorsal region foxa2 expression absent, abnormal	gdf3^pr05/pr05	standard conditions	Fig. 2 from Pelliccia et al., 2017
whole organism dorsal region noto expression absent, abnormal	gdf3^pr05/pr05	standard conditions	Fig. 2 from Pelliccia et al., 2017
whole organism ventral region ab1-smad labeling increased amount, abnormal	gdf3^pr05/pr05	standard conditions	Fig. 3 from Pelliccia et al., 2017
margin dorsal region tbxta expression absent, abnormal	gdf3^pr05/pr05	standard conditions	Fig. 2 from Pelliccia et al., 2017
whole organism ventral region eve1 expression increased amount, abnormal	gdf3^pr05/pr05	standard conditions	Fig. 3 from Pelliccia et al., 2017
whole organism ventral region eve1 expression increased distribution, abnormal	gdf3^pr05/pr05	standard conditions	Fig. 3 from Pelliccia et al., 2017
mesoderm formation decreased occurrence, abnormal	gdf3^pr05/pr05	standard conditions	Fig. 1 from Pelliccia et al., 2017
whole organism dorsal region chrd expression decreased distribution, abnormal	gdf3^pr05/pr05	standard conditions	Fig. 3 from Pelliccia et al., 2017
margin sox17 expression absent, abnormal	gdf3^pr05/pr05	standard conditions	Fig. 2 from Pelliccia et al., 2017
whole organism morphology, abnormal	gdf3^pr05/pr05	standard conditions	Fig. 1 from Pelliccia et al., 2017
margin lft1 expression absent, abnormal	gdf3^pr05/pr05	standard conditions	Fig. 2 from Pelliccia et al., 2017
margin ndr2 expression absent, abnormal	gdf3^pr05/pr05	standard conditions	Fig. 2 from Pelliccia et al., 2017
whole organism dorsal region chrd expression decreased amount, abnormal	gdf3^pr05/pr05	standard conditions	Fig. 3 from Pelliccia et al., 2017
whole organism ventral region ab1-smad labeling increased distribution, abnormal	gdf3^pr05/pr05	standard conditions	Fig. 3 from Pelliccia et al., 2017
whole organism dorsal region gsc expression absent, abnormal	gdf3^pr05/pr05	standard conditions	Fig. 2 , Fig. 3 from Pelliccia et al., 2017
endoderm formation decreased occurrence, abnormal	gdf3^pr05/pr05	standard conditions	Fig. 1 from Pelliccia et al., 2017
margin ndr2 expression absent, abnormal	gdf3^pr05/+	standard conditions	Fig. 2 from Pelliccia et al., 2017
margin lft1 expression absent, abnormal	gdf3^pr05/+	standard conditions	Fig. 2 from Pelliccia et al., 2017
whole organism dorsal region gsc expression absent, abnormal	gdf3^pr05/+	standard conditions	Fig. 2 from Pelliccia et al., 2017
whole organism morphology, abnormal	gdf3^pr05	standard conditions	Fig. 1 from Pelliccia et al., 2017
mesoderm formation decreased occurrence, abnormal	gdf3^pr05	standard conditions	Fig. 1 from Pelliccia et al., 2017
endoderm formation decreased occurrence, abnormal	gdf3^pr05	standard conditions	Fig. 1 from Pelliccia et al., 2017
endoderm formation decreased occurrence, abnormal	gdf3^pr05/pr05 + MO1-ndr2 + MO4-ndr1	standard conditions	Fig. 3 from Pelliccia et al., 2017
mesoderm formation decreased occurrence, abnormal	gdf3^pr05/pr05 + MO1-ndr2 + MO4-ndr1	standard conditions	Fig. 3 from Pelliccia et al., 2017
caudal fin morphology, exacerbated	gdf3^pr05/pr05 + MO1-ndr2 + MO4-ndr1	standard conditions	Fig. 3 from Pelliccia et al., 2017

Citations