CRISPR

CRISPR1-gpx4b

ID
ZDB-CRISPR-170627-1
Name
CRISPR1-gpx4b
Previous Names
None
Target
Sequence
5' - GAGAAGGGTTTACGCATCCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ouc1 gpx4b
ouc2 gpx4b
Expression
Gene expression in Wild Types + CRISPR1-gpx4b
No data available
Phenotype
Phenotype resulting from CRISPR1-gpx4b
No data available
Phenotype of all Fish created by or utilizing CRISPR1-gpx4b
Phenotype Fish Conditions Figures
whole organism dharma expression increased amount, abnormal gpx4bouc1/ouc1 standard conditions Fig. 2 with image from Rong et al., 2017
anatomical structure cdx4 expression increased amount, abnormal gpx4bouc1/ouc1 standard conditions Fig. 2 with image from Rong et al., 2017
whole organism ndr1 expression increased amount, abnormal gpx4bouc1/ouc1 standard conditions Fig. 2 with image from Rong et al., 2017
whole organism vent expression increased amount, abnormal gpx4bouc1/ouc1 standard conditions Fig. 2 with image from Rong et al., 2017
whole organism cdx4 expression increased amount, abnormal gpx4bouc1/ouc1 standard conditions Fig. 2 with image from Rong et al., 2017
whole organism sp5l expression increased amount, abnormal gpx4bouc1/ouc1 standard conditions Fig. 2 with image from Rong et al., 2017
Wnt signaling pathway increased occurrence, abnormal gpx4bouc1/ouc1 standard conditions Fig. 2 with image from Rong et al., 2017
whole organism chrd expression increased amount, abnormal gpx4bouc1/ouc1 standard conditions Fig. 2 with image from Rong et al., 2017
anatomical structure tbx6 expression increased amount, abnormal gpx4bouc1/ouc1 standard conditions Fig. 2 with image from Rong et al., 2017
whole organism ccnd1 expression increased amount, abnormal gpx4bouc1/ouc1 standard conditions Fig. 2 with image from Rong et al., 2017
whole organism axin2 expression increased amount, abnormal gpx4bouc1/ouc1 standard conditions Fig. 2 with image from Rong et al., 2017
whole organism dorsal region chrd expression increased distribution, abnormal gpx4bouc1/ouc1 standard conditions Fig. 2 with image from Rong et al., 2017
anatomical structure sp5l expression increased amount, abnormal gpx4bouc1/ouc1 standard conditions Fig. 2 with image from Rong et al., 2017
whole organism dorsal region gsc expression increased distribution, abnormal gpx4bouc1/ouc1 standard conditions Fig. 2 with image from Rong et al., 2017
whole organism ndr1 expression increased amount, abnormal gpx4bouc1 standard conditions Fig. 2 with image from Rong et al., 2017
whole organism chrd expression increased amount, abnormal gpx4bouc1 standard conditions Fig. 2 with image from Rong et al., 2017
caudal fin decreased size, abnormal gpx4bouc1 standard conditions Fig. 1 with image from Rong et al., 2017
whole organism dorsal region chrd expression increased distribution, abnormal gpx4bouc1 standard conditions Fig. 2 with image from Rong et al., 2017
whole organism dorsal region gsc expression increased distribution, abnormal gpx4bouc1 standard conditions Fig. 2 with image from Rong et al., 2017
whole organism dharma expression increased amount, abnormal gpx4bouc1 standard conditions Fig. 2 with image from Rong et al., 2017
caudal fin decreased size, abnormal gpx4bouc2 standard conditions Fig. 1 with image from Rong et al., 2017
Citations