Mapping Details

Genome Browser Chr Position Assembly NCBI Map Viewer 19 19,767,576 - 19,769,373 GRCz11

Mapped Clones containing hoxa4a
DKEY-25E11	Chr: 19 Details

GENETIC MAPPING PANELS

Chr	Location	Mapped As	Panel	Mapped By	Scoring
19	211.12 cR	Hoxx4	Loeb/NIH/5000/4000 (LN54)	Johnson, Stephen L.	Data
Note: Physical map location as displayed in the genome browsers is more precise than linkage map location. Note: Physical map location should be used whenever possible.

MAPPING FROM PUBLICATIONS

Marker	Type	Chr	Distance	Publication / Person	Comments
hoxa1a	GENE	19		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx1, hoxa13a, hoxa11a, hoxa10ap, hoxa9a, hoxa5a, hoxa4a, hoxa3a, and hoxa1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG19.
hoxa11a	GENE	19		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx1, hoxa13a, hoxa11a, hoxa10ap, hoxa9a, hoxa5a, hoxa4a, hoxa3a, and hoxa1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG19.
hoxa5a	GENE	19		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx1, hoxa13a, hoxa11a, hoxa10ap, hoxa9a, hoxa5a, hoxa4a, hoxa3a, and hoxa1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG19.
evx1	GENE	19		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx1, hoxa13a, hoxa11a, hoxa10ap, hoxa9a, hoxa5a, hoxa4a, hoxa3a, and hoxa1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG19.
hoxa13a	GENE	19		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx1, hoxa13a, hoxa11a, hoxa10ap, hoxa9a, hoxa5a, hoxa4a, hoxa3a, and hoxa1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG19.
hoxa10ap	GENEP	19		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx1, hoxa13a, hoxa11a, hoxa10ap, hoxa9a, hoxa5a, hoxa4a, hoxa3a, and hoxa1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG19.
hoxa9a	GENE	19		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx1, hoxa13a, hoxa11a, hoxa10ap, hoxa9a, hoxa5a, hoxa4a, hoxa3a, and hoxa1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG19.
hoxa3a	GENE	19		Amores et al., 1998	Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx1, hoxa13a, hoxa11a, hoxa10ap, hoxa9a, hoxa5a, hoxa4a, hoxa3a, and hoxa1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG19.
smb409Et	Feature	19		Punnamoottil et al., 2008	Punnamoottil, et al. (2008.Dev. Dyn. 237(8): 2195-2208) mapped the proviral  ... Punnamoottil, et al. (2008.Dev. Dyn. 237(8): 2195-2208) mapped the proviral insertion Et(CLG-YFP)smb409 (CLGY409) to a position 0.8 kb upstream of hoxa4a on LG19. The genomic sequence flanking the CLGY409 insertion (AATGTAGACAAAATGTGCTGCCACAGGCCTATATCAATAAAAAAAAACTGTCCAGTT) was BLASTed against Ensembl assembly Zv7.

OTHER MAPPING INFORMATION

Chr 19 Amores et al., 1998 Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx1,  ... Using overlapping PAC clones, Amores, et al. (1998. Science 282:1711-1714.) report evx1, hoxa13a, hoxa11a, hoxa10ap, hoxa9a, hoxa5a, hoxa4a, hoxa3a, and hoxa1a are clustered on a continuous region of the genome. Subsequent mapping of one or more of these genes localize all to LG19.   Chr 19 Punnamoottil et al., 2008 Punnamoottil, et al. (2008.Dev. Dyn. 237(8): 2195-2208) mapped the proviral insertion  ... Punnamoottil, et al. (2008.Dev. Dyn. 237(8): 2195-2208) mapped the proviral insertion Et(CLG-YFP)smb409 (CLGY409) to a position 0.8 kb upstream of hoxa4a on LG19. The genomic sequence flanking the CLGY409 insertion (AATGTAGACAAAATGTGCTGCCACAGGCCTATATCAATAAAAAAAAACTGTCCAGTT) was BLASTed against Ensembl assembly Zv7.

Markers Encoded by hoxa4a
zf-es36 Chr: 19 Details