| ZFIN ID: ZDB-GENE-980526-16 |
| Gene Name: | endothelin receptor Ba |
|---|---|
| Symbol: | ednrba |
PHYSICAL MAP AND BROWSER
|
| Mapped Clones containing ednrba | |
|---|---|
| BUSM1-27N24 | Chr: 1 Details |
PHYSICAL MAPPING
| Feature | Chr | Position | Assembly | Citations |
|---|---|---|---|---|
| j3e1 | 1 | 28,627,337 | GRCz11 | Parichy et al., 2000 |
| j3e2 | 1 | 28,628,257 | GRCz11 | Parichy et al., 2000 |
| j3e3 | 1 | 28,628,088 | GRCz11 | Parichy et al., 2000 |
| Chr | Location | Mapped As | Panel | Mapped By | Scoring |
|---|---|---|---|---|---|
| 1 | 82.1 cM | ednrb1 | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
| 1 | 266.9 cR | ednrb1 | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
| 1 | 3231.0 cR | ednrb1 | Goodfellow T51 (T51) | Geisler, Robert | Data |
| Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
|||||
| Marker | Type | Chr | Distance | Publication / Person | Comments |
|---|---|---|---|---|---|
| bmp1l | GENE | 1 | Reifers et al., 2000 |
fgf17 was mapped to LG1 on the Goodfellow T51 RH panel by Reifers et al. (2000 Mech. of Dev. 99:39-49). At the time of mapping, the authors located bmp1 (now bmp1l) at 33 cM, fgf17 at 34.8-38.8 cM, Pou4f1 at 39.9-42.4 cM and ednrb1 at 54.3 cM. The mapping reported in Reifers et al. linked fgf17 to pou4f2. This reported linkage has been updated to link fgf17 to pou4f1 after further analysis of synteny and sequence information. |
|
| pou4f1 | GENE | 1 | Reifers et al., 2000 |
fgf17 was mapped to LG1 on the Goodfellow T51 RH panel by Reifers et al. (2000 Mech. of Dev. 99:39-49). At the time of mapping, the authors located bmp1 (now bmp1l) at 33 cM, fgf17 at 34.8-38.8 cM, Pou4f1 at 39.9-42.4 cM and ednrb1 at 54.3 cM. The mapping reported in Reifers et al. linked fgf17 to pou4f2. This reported linkage has been updated to link fgf17 to pou4f1 after further analysis of synteny and sequence information. |
|
| fgf8b | GENE | 1 | 17.5 cM | Reifers et al., 2000 |
fgf17 was mapped to LG1 on the Goodfellow T51 RH panel by Reifers et al. (2000 Mech. of Dev. 99:39-49). At the time of mapping, the authors located bmp1 (now bmp1l) at 33 cM, fgf17 at 34.8-38.8 cM, Pou4f1 at 39.9-42.4 cM and ednrb1 at 54.3 cM. The mapping reported in Reifers et al. linked fgf17 to pou4f2. This reported linkage has been updated to link fgf17 to pou4f1 after further analysis of synteny and sequence information. |
| Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
|---|---|---|---|
| SJD | 340 | AluI | 36.0 |
| Forward Primer | CACTGTGCTGGCTTCCACTG | ||
| Reverse Primer | ATTCTTAAAGCGCTTGCTAACCAT |
| Genomic Feature b140 is an allele of ednrba |