ZFIN ID: ZDB-GENE-980526-166 |
Gene Name: | sonic hedgehog signaling molecule a |
---|---|
Symbol: | shha |
PHYSICAL MAP AND BROWSER
|
||||||||||||||||||||||||
|
Mapped Clones containing shha | |
---|---|
CH211-105D1 | Chr: 7 Details |
CH211-150E22 | Chr: 7 Details |
PHYSICAL MAPPING
No data available
Chr | Location | Mapped As | Panel | Mapped By | Scoring |
---|---|---|---|---|---|
7 | 111.6 cM | shh | Mother of Pearl (MOP) | Postlethwait, John H. | Data |
7 | 165.63 cR | shh | Loeb/NIH/5000/4000 (LN54) | Dawid, Igor B. | Data |
7 | 4073.0 cR | shh | Goodfellow T51 (T51) | Geisler, Robert | Data |
7 | 86.7 cM | shh | Heat Shock (HS) | Woods, Ian G. | Data |
Note: Physical map location as
displayed in the genome browsers is more precise than linkage map location. Physical map location should be used whenever possible. |
Marker | Type | Chr | Distance | Publication / Person | Comments |
---|---|---|---|---|---|
en2a | GENE | 7 | Bertrand et al., 2001 | Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel. | |
ccne1 | GENE | 7 | Bertrand et al., 2001 | Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel. | |
isl2b | GENE | 7 | Bertrand et al., 2001 | Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel. | |
foxb1b | GENE | 7 | Bertrand et al., 2001 | Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel. | |
z1059 | SSLP | 7 | Bertrand et al., 2001 | Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel. | |
z1182 | SSLP | 7 | Bertrand et al., 2001 | Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel. | |
z3445 | SSLP | 7 | Bertrand et al., 2001 | Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel. | |
z4706 | SSLP | 7 | Bertrand et al., 2001 | Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel. | |
ache | GENE | 7 | Bertrand et al., 2001 | Bertrand, C. et al. (2001, J. Biol. Chem. 276(1):464-474) mapped ache to LG7 on the MOP panel. |
|
Markers Encoded by shha | |||
---|---|---|---|
fc83d08 Chr: 7 Details |
Strain | Bandsize | Restriction Enzyme | Annealing Temperature [C] |
---|---|---|---|
SJD | 369 | MnlI | 36.0 |
Forward Primer | ACACACACACGGAGTCGAAT | ||
Reverse Primer | AAAGAAACAGCTCAAGACTGCA |
Genomic Feature shha_unspecified is an allele of shha |