TALEN

TALEN1-runx1

ID

ZDB-TALEN-230817-1

Name

TALEN1-runx1

Previous Names

None

Target

runx1 (1)

Target Sequence 1

5' - TTGCCCTTGGTGATATCCCAG - 3'

Target Sequence 2

5' - TCATCATTTCCCGCCATCACT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
hg96	runx1
hg97	runx1

Expression

Gene expression in Wild Types + TALEN1-runx1

No data available

Phenotype

Phenotype resulting from TALEN1-runx1

No data available

Phenotype of all Fish created by or utilizing TALEN1-runx1

Phenotype	Fish	Conditions	Figures
kidney myeloid cell mpx expression decreased amount, abnormal	runx1^hg96/hg96	standard conditions	Figure 1. from Bresciani et al., 2021
kidney thrombocyte thbs1b expression decreased amount, abnormal	runx1^hg96/hg96	standard conditions	Figure 1. from Bresciani et al., 2021
kidney thrombocyte apln expression decreased amount, abnormal	runx1^hg96/hg96	standard conditions	Figure 1. from Bresciani et al., 2021
kidney hematopoietic multipotent progenitor cell gata2b expression increased amount, abnormal	runx1^hg96/hg96	standard conditions	Figure 1. from Bresciani et al., 2021
kidney thrombocyte mpl expression decreased amount, abnormal	runx1^hg96/hg96	standard conditions	Figure 1. from Bresciani et al., 2021
kidney thrombocyte itgb3a expression decreased amount, abnormal	runx1^hg96/hg96	standard conditions	Figure 1. from Bresciani et al., 2021
kidney thrombocyte itga2b expression decreased amount, abnormal	runx1^hg96/hg96	standard conditions	Figure 1. from Bresciani et al., 2021
kidney myeloid cell lyz expression decreased amount, abnormal	runx1^hg96/hg96	standard conditions	Figure 1. from Bresciani et al., 2021
kidney hematopoietic multipotent progenitor cell gata2b expression increased amount, abnormal	runx1^hg97/hg97	standard conditions	Figure 1. from Bresciani et al., 2021
kidney myeloid cell mpx expression decreased amount, abnormal	runx1^hg97/hg97	standard conditions	Figure 1. from Bresciani et al., 2021
kidney thrombocyte thbs1b expression decreased amount, abnormal	runx1^hg97/hg97	standard conditions	Figure 1. from Bresciani et al., 2021
kidney thrombocyte apln expression decreased amount, abnormal	runx1^hg97/hg97	standard conditions	Figure 1. from Bresciani et al., 2021
kidney thrombocyte mpl expression decreased amount, abnormal	runx1^hg97/hg97	standard conditions	Figure 1. from Bresciani et al., 2021
kidney thrombocyte itgb3a expression decreased amount, abnormal	runx1^hg97/hg97	standard conditions	Figure 1. from Bresciani et al., 2021
kidney myeloid cell lyz expression decreased amount, abnormal	runx1^hg97/hg97	standard conditions	Figure 1. from Bresciani et al., 2021
kidney thrombocyte itga2b expression decreased amount, abnormal	runx1^hg97/hg97	standard conditions	Figure 1. from Bresciani et al., 2021
hematopoietic cell meis1b expression increased amount, abnormal	runx1^hg96/hg96; la2Tg/la2Tg; sd2Tg/sd2Tg	standard conditions	Figure 4. from Bresciani et al., 2021
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell EGFP expression increased amount, abnormal	runx1^hg96/hg96; la2Tg/la2Tg; sd2Tg/sd2Tg	standard conditions	Figure 2. from Bresciani et al., 2021
hematopoietic multipotent progenitor cell meis1b expression increased amount, abnormal	runx1^hg96/hg96; la2Tg/la2Tg; sd2Tg/sd2Tg	standard conditions	Figure 4. from Bresciani et al., 2021
thrombocyte EGFP expression decreased amount, abnormal	runx1^hg96/hg96; la2Tg/la2Tg; sd2Tg/sd2Tg	standard conditions	Figure 1. from Bresciani et al., 2021
hematopoietic multipotent progenitor cell meis1b expression spatial pattern, abnormal	runx1^hg96/hg96; la2Tg/la2Tg; sd2Tg/sd2Tg	standard conditions	Figure 4. from Bresciani et al., 2021
hematopoietic multipotent progenitor cell fli1 expression increased amount, abnormal	runx1^hg96/hg96; la2Tg/la2Tg; sd2Tg/sd2Tg	standard conditions	Figure 4. from Bresciani et al., 2021
hematopoietic cell gata2b expression increased amount, abnormal	runx1^hg96/hg96; la2Tg/la2Tg; sd2Tg/sd2Tg	standard conditions	Figure 4. from Bresciani et al., 2021
hematopoietic multipotent progenitor cell gata2b expression spatial pattern, abnormal	runx1^hg96/hg96; la2Tg/la2Tg; sd2Tg/sd2Tg	standard conditions	Figure 4. from Bresciani et al., 2021
hematopoietic cell fli1 expression increased amount, abnormal	runx1^hg96/hg96; la2Tg/la2Tg; sd2Tg/sd2Tg	standard conditions	Figure 4. from Bresciani et al., 2021
hematopoietic multipotent progenitor cell fli1 expression spatial pattern, abnormal	runx1^hg96/hg96; la2Tg/la2Tg; sd2Tg/sd2Tg	standard conditions	Figure 4. from Bresciani et al., 2021
nucleate erythrocyte DsRed expression decreased amount, abnormal	runx1^hg96/hg96; la2Tg/la2Tg; sd2Tg/sd2Tg	standard conditions	Figure 1. from Bresciani et al., 2021
ventral wall of dorsal aorta regulation of hematopoietic stem cell migration decreased rate, abnormal	runx1^hg96/hg96; la2Tg/la2Tg; sd2Tg/sd2Tg	standard conditions	Figure 2. from Bresciani et al., 2021
hematopoietic multipotent progenitor cell gata2b expression increased amount, abnormal	runx1^hg96/hg96; la2Tg/la2Tg; sd2Tg/sd2Tg	standard conditions	Figure 4. , Figure 5. from Bresciani et al., 2021
whole organism viability, abnormal	runx1^hg96/hg96; gata2b^hg94/hg94	standard conditions	Figure 6. from Bresciani et al., 2021
head kidney hematopoietic multipotent progenitor cell decreased amount, abnormal	gata2a^hg123/+; gata2b^hg95/hg95; runx1^hg96/hg96	standard conditions	Figure 6. from Bresciani et al., 2021
head kidney hematopoietic multipotent progenitor cell decreased amount, abnormal	gata2a^hg123/hg123; gata2b^hg95/+; runx1^hg96/hg96	standard conditions	Figure 6. from Bresciani et al., 2021
head kidney hematopoietic multipotent progenitor cell decreased amount, abnormal	gata2a^hg123/hg123; gata2b^hg95/hg95; runx1^hg96/hg96	standard conditions	Figure 6. from Bresciani et al., 2021

Citations